TPM1 mutation Leu185Arg

The Leu185Arg mutation of human alpha-Tropomyosin

(other names: L185R)

sequence
restriction enzyme
clinical information
references and comments

**SEQUENCE**
exon	5
nucleotide change	T>G
nucleotide pos. in gene	19158
UCSC Golden Path position	61140182
amino acid change	Leu>Arg
charge change	+1
codon change	CTC>CGC
transcript change	missense
translation change	substitution, non-conservative

mutated amplimer sequence:
acccccatgcccttctgttacacaaagcttgcaagacccatggtgtgtgt
gttgtgtcttcctgctgcaggtggcccgtaagctggtcatcattgagagc
gacctggaacgtgcagaggagcgggctgagcGctcagaagggtaagcggg
cccggcgccaggaggccacgaatggggtgctgcagagcagtgactaaaca
gcatgaccttctggcagctgcacattacctgtttcagctccgggctcctt
ttg

**RESTRICTION ENZYME**
no information

disease	HCM
clinical consequences	early onset, sudden death in childhood, profoundly arrythmogenic.

References and comments

Van Driest SL, Will ML, Atkins DL, Ackerman MJ.
A novel TPM1 mutation in a family with hypertrophic cardiomyopathy and sudden cardiac death in childhood.
Am J Cardiol 2002 Nov 15;90(10):1123-7. (PubMed:12423715)
Earing MG, Ackerman MJ, O'Leary PW.
Diastolic ventricular dysfunction as a marker for hypertrophic cardiomyopathy in a family with a novel alpha-tropomyosin mutation.
J Am Soc Echocardiogr 2003 Jun;16(6):698-702. (PubMed:12778034)
- An abnormal LV diastolic filling pattern is a better indicator of the presence of this mutation than LV hypertrophy is, in the family studied.
Van Driest SL, Ellsworth EG, Ommen SR, Tajik AJ, Gersh BJ, Ackerman MJ.
Prevalence and spectrum of thin filament mutations in an outpatient referral population with hypertrophic cardiomyopathy.
Circulation 2003 Jul 29;108(4):445-51. Epub 2003 Jul 14. (PubMed:12860912)

citations & disclaimer | contact us

Last modified: April 24, 2006