Project 3 > Mutation Database > TPM1 mutations > Glu180Gly

The Glu180Gly mutation of human alpha-Tropomyosin

(other names:  E180G)

SEQUENCE
exon 5
nucleotide change A>G
nucleotide pos. in gene 19143
UCSC Golden Path position 61140167
amino acid changeGlu>Gly
charge change +1
codon change GAG>GGG
transcript change missense
translation change substitution


mutated amplimer sequence:
acccccatgcccttctgttacacaaagcttgcaagacccatggtgtgtgt
gttgtgtcttcctgctgcaggtggcccgtaagctggtcatcattgagagc
gacctggaacgtgcagGggagcgggctgagctctcagaagggtaagcggg
cccggcgccaggaggccacgaatggggtgctgcagagcagtgactaaaca
gcatgaccttctggcagctgcacattacctgtttcagctccgggctcctt
ttg


RESTRICTION ENZYME
restriction enzyme Mnl I site lost
fragment sizes, wild-type strand (bp) 105, 58, 46
fragment sizes, mutant strand (bp) 151, 58

 
disease HCM

 
    References and comments
  1. dbSNP: rs28934269 (Submitter: OMIMSNP*)
  2. Thierfelder L, Watkins H, MacRae C, Lamas R, McKenna W, Vosberg HP, Seidman JG, Seidman CE.
    Alpha-tropomyosin and cardiac troponin T mutations cause familial hypertrophic cardiomyopathy: a disease of the sarcomere.
    Cell 1994 Jun 3;77(5):701-12. (PubMed:8205619)
  3. Prabhakar R, Boivin GP, Grupp IL, Hoit B, Arteaga G, Solaro JR, Wieczorek DF.
    A familial hypertrophic cardiomyopathy alpha-tropomyosin mutation causes severe cardiac hypertrophy and death in mice.
    J Mol Cell Cardiol 2001 Oct;33(10):1815-28. (PubMed:11603924)
  4. Prabhakar R, Petrashevskaya N, Schwartz A, Aronow B, Boivin GP, Molkentin JD, Wieczorek DF.
    A mouse model of familial hypertrophic cardiomyopathy caused by a alpha-tropomyosin mutation.
    Mol Cell Biochem. 2003 Sep;251(1-2):33-42. (PubMed:14575301)
 

citations & disclaimer | contact us

Last modified: April 24, 2006