Project 3 > Mutation Database > TNNT2 mutations > Phe110Ile

The Phe110Ile mutation of human cardiac Troponin T

(other names:  F110I)

mutated amplimer sequence:
ggatcagggccctgcctgtcctggacaccctcagtccctgggtccagaat
ggggctgatgctgactattcctctctccaacaggtcgttcatgcccaact
tggtgcctcccaagatccccgatggagagagagtggactttgatgtaagc
ggtggctgtgggttgagtaggcctgggctggggatagtcccaagggccct
cagtgacagagattttgtgaccttgggctggggtagagcataggtgggat
ggggtgcagcaccagccaggctgggtgcccatccatgagcgtggtcctgg
gttcaggccacagttaccccttccctggccaggcgccaggccctgccaga
ggtcttttgcactgcgttggggggtgtctagcccacccatctctcctctg
gactctttggagtggcagcctctgagccgcagcggtccacccacaggaca
tccaccggaagcgcatggagaaggacctgaatgagttgcaggcgctgatc
gaggctcacAttgagaacaggaagaaagaggaggagga

References and comments
1. Watkins H, McKenna WJ, Thierfelder L, Suk HJ, Anan R, O'Donoghue A, Spirito P, Matsumori A, Moravec CS, Seidman JG, et al..
   Mutations in the genes for cardiac troponin T and alpha-tropomyosin in hypertrophic cardiomyopathy.
   N Engl J Med 1995 Apr 20;332(16):1058-64. (PubMed:7898523)
2. Nakata et al., 1996. (abstract)
3. Anan R, Shono H, Kisanuki A, Arima S, Nakao S, Tanaka H.
   Patients with familial hypertrophic cardiomyopathy caused by a Phe110Ile missense mutation in the cardiac troponin T gene have variable cardiac morphologies and a favorable prognosis.
   Circulation 1998 Aug 4;98(5):391-7. (PubMed:9714088)
   • F110I identified in 16 individuals in 5 families (5 different haplotypes). Three of the 16 had apical hypertrophy, and 3 had no disease.
4. Yanaga F, Morimoto S, Ohtsuki I.
   Ca2+ sensitization and potentiation of the maximum level of myofibrillar ATPase activity caused by mutations of troponin T found in familial hypertrophic cardiomyopathy.
   J Biol Chem 1999 Mar 26;274(13):8806-12. (PubMed:10085122)
5. Lin T, Ichihara S, Yamada Y, Nagasaka T, Ishihara H, Nakashima N, Yokota M.
   Phenotypic variation of familial hypertrophic cardiomyopathy caused by the Phe(110)-->Ile mutation in cardiac troponin T.
   Cardiology 2000;93(3):155-62. (PubMed:10965086)
   • homozygote
   • F110I homozygotes had more severe hypertrophy than F110I heterozygotes in the same Japanese family. Some hets did not have hypertrophy. Apical hypertrophy not seen.
6. Palm T, Graboski S, Hitchcock-DeGregori SE, Greenfield NJ.
   Disease-causing mutations in cardiac troponin T: identification of a critical tropomyosin-binding region.
   Biophys J 2001 Nov;81(5):2827-37. (PubMed:11606294)
7. Hinkle A, Tobacman LS.
   Folding and function of the troponin tail domain. Effects of cardiomyopathic troponin T mutations.
   J Biol Chem 2003 Jan 3;278(1):506-13. Epub 2002 Oct 29. (PubMed:12409295)
8. Konno T, Shimizu M, Ino H, Fujino N, Hayashi K, Uchiyama K, Kaneda T, Inoue M, Masuda E, Mabuchi H.
   Phenotypic differences between electrocardiographic and echocardiographic determination of hypertrophic cardiomyopathy in genetically affected subjects.
   J Intern Med. 2005 Sep;258(3):216-24. (PubMed:16115294)
9. Hernandez OM, Szczesna-Cordary D, Knollmann BC, Miller T, Bell M, Zhao J, Sirenko SG, Diaz Z, Guzman G, Xu Y, Wang Y, Kerrick WG, Potter JD.
   F110I and R278C troponin T mutations that cause familial hypertrophic cardiomyopathy affect muscle contraction in transgenic mice and reconstituted human cardiac fibers.
   J Biol Chem. 2005 Nov 4;280(44):37183-94. Epub 2005 Aug 22. (PubMed:16115869)

citations & disclaimer | contact us

Last modified: April 24, 2006