Project 3 > Mutation Database > TNNT2 mutations > Lys253Arg

The Lys253Arg mutation of human cardiac Troponin T

(other names:  K253R, I253R, Ile253Arg)

mutated amplimer sequence:
ggagggccctttcttactggacctccccattctcacccttgcccgtgcag
ggagaaggccaaggagctgtggcagagcatctataacttggaggcagaga
agttcgacctgcaggagaGgttcaagcagcagaaatatgaggtgggccgc
catgctgtccccgcccagcatctccatctcacactcctcctggttcactg
ggtccgg

References and comments
1. dbSNP: rs3730238 (Submitter: WI_PGA)
2. Watkins H, McKenna WJ, Thierfelder L, Suk HJ, Anan R, O'Donoghue A, Spirito P, Matsumori A, Moravec CS, Seidman JG, et al..
   Mutations in the genes for cardiac troponin T and alpha-tropomyosin in hypertrophic cardiomyopathy.
   N Engl J Med 1995 Apr 20;332(16):1058-64. (PubMed:7898523)
   • Did not segregate with disease, and present of 2 of 100 normal individuals.
3. Morner S, Richard P, Kazzam E, Hellman U, Hainque B, Schwartz K, Waldenstrom A.
   Identification of the genotypes causing hypertrophic cardiomyopathy in northern Sweden.
   J Mol Cell Cardiol 2003 Jul;35(7):841-9. (PubMed:12818575)
   • K253R seen in 15 of 46 HCM probands; considered a polymorphism.
4. Miliou A, Anastasakis A, D'Cruz LG, Theopistou A, Rigopoulos A, Rizos I, Stamatelopoulos S, Toutouzas P, Stefanadis C.
   Low prevalence of cardiac troponin T mutations in a Greek hypertrophic cardiomyopathy cohort.
   Heart 2005 Jul;91(7):966-7. (PubMed:15958377)
   • Called "Ile253Arg". Considered to be a polymorphism.

citations & disclaimer | contact us

Last modified: April 24, 2006