Project 3 > Mutation Database > TNNT2 mutations > Lys210del

The Lys210del mutation of human cardiac Troponin T

(other names:  K210del)

SEQUENCE
exon 13
nucleotide change del AGA
nucleotide pos. in gene 12096..12098
UCSC Golden Path position 198062758..198062756
amino acid changedel Lys
charge change  
codon change  
transcript change inframe deletion
translation change deletion


mutated amplimer sequence:
cagggggtttggggagggttaggggacagggagggggcaatctggccagt
ttactctgcttcccacaccctccagacagagcggaaaagtgggaagaggc
agactgagcgggaaaagaagaagATtctggctgagaggaggaaggtgctg
gccattgaccacctgaatgaagatcagctgaggtgggggctgggaggaat
ggtcctggggcactgcccgcatctgctctgggaggggtcgggccaagggc
acttcttgctgtgagccaccagagggcaggactgcctcacatattttccc
atggcaagtttggtgggaccagagctgggccccagcaggtcgggccaact
cctttctgggctttgctgatggggaaagagaactgagcaggtgccccac


RESTRICTION ENZYME
None

 
disease DCM
clinical consequencesearly onset, sudden death at early age

 
    References and comments
  1. Kamisago M, Sharma SD, DePalma SR, Solomon S, Sharma P, McDonough B, Smoot L, Mullen MP, Woolf PK, Wigle ED, Seidman JG, Seidman CE.
    Mutations in sarcomere protein genes as a cause of dilated cardiomyopathy.
    N Engl J Med 2000 Dec 7;343(23):1688-96. (PubMed:11106718)
  2. Hanson EL, Jakobs PM, Keegan H, Coates K, Bousman S, Dienel NH, Litt M, Hershberger RE.
    Cardiac troponin T lysine 210 deletion in a family with dilated cardiomyopathy.
    J Card Fail 2002 Feb;8(1):28-32. (PubMed:11862580)
  3. Venkatraman G, Harada K, Gomes AV, Kerrick WG, Potter JD.
    Different functional properties of troponin T mutants that cause dilated cardiomyopathy.
    J Biol Chem 2003 Oct 24;278(43):41670-6. Epub 2003 Aug 14. (PubMed:12923187)
  4. Mogensen J, Murphy RT, Shaw T, Bahl A, Redwood C, Watkins H, Burke M, Elliott PM, McKenna WJ.
    Severe disease expression of cardiac troponin C and T mutations in patients with idiopathic dilated cardiomyopathy.
    J Am Coll Cardiol 2004 Nov 16;44(10):2033-40. (PubMed:15542288)


Clinical features of individuals in this study having the TNNT2:Lys210del mutation.
pedigree sex height (in.) weight (lb.) age of onset age at exam NYHA Class LVWT, mm. LVED LVES LA EF, % diagnosis
MAH F       51     51 35 29   DCM
MDI M       54 III   74 70     DCM
MDI F       38 II   68 59     DCM
MDI F       64 III   63 55     DCM

citations & disclaimer | contact us

Last modified: April 24, 2006