Project 3 > Mutation Database > TNNT2 mutations > Glu163del

The Glu163del mutation of human cardiac Troponin T

(other names:  E163del, E160del)

mutated amplimer sequence:
tgggagctaccctctcagaaagctccttgctgagcggagagaaagctgaa
ctcacccataaagaccacaagcttcagcccagaatcagggtttccaatcc
tttcccctaatttgctttcttcctccctgctgtaaatcaggaagagaggg
ctcgacgagaggaggaGAgaacaggaggaaggctgaggatgaggcccgga
agaagaaggctttgtccaacatgatgcattttgggggttacatccagaag
gtaggtagggagcagcaggggttgccaggagatcctagtatagccctgag
gaatgaggtgtccactgcagcaggtagactttaggtcaggtcccaggaag
agattcccagctgctgtg

References and comments
1. Watkins H, McKenna WJ, Thierfelder L, Suk HJ, Anan R, O'Donoghue A, Spirito P, Matsumori A, Moravec CS, Seidman JG, et al..
   Mutations in the genes for cardiac troponin T and alpha-tropomyosin in hypertrophic cardiomyopathy.
   N Engl J Med 1995 Apr 20;332(16):1058-64. (PubMed:7898523)
   • One of 2 families was linked to TNNT2 locus.
2. Palm T, Graboski S, Hitchcock-DeGregori SE, Greenfield NJ.
   Disease-causing mutations in cardiac troponin T: identification of a critical tropomyosin-binding region.
   Biophys J 2001 Nov;81(5):2827-37. (PubMed:11606294)
3. Richard P, Charron P, Carrier L, Ledeuil C, Cheav T, Pichereau C, Benaiche A, Isnard R, Dubourg O, Burban M, Gueffet JP, Millaire A, Desnos M, Schwartz K, Hainque B, Komajda M.
   Hypertrophic cardiomyopathy: distribution of disease genes, spectrum of mutations, and implications for a molecular diagnosis strategy.
   Circulation 2003 May 6;107(17):2227-32. Epub 2003 Apr 21. (PubMed:12707239)
4. Mogensen J, Bahl A, Kubo T, Elanko N, Taylor R, McKenna WJ.
   Comparison of fluorescent SSCP and denaturing HPLC analysis with direct sequencing for mutation screening in hypertrophic cardiomyopathy.
   J Med Genet 2003 May;40(5):e59. (PubMed:12746413)
5. Torricelli F, Girolami F, Olivotto I, Passerini I, Frusconi S, Vargiu D, Richard P, Cecchi F.
   Prevalence and clinical profile of troponin T mutations among patients with hypertrophic cardiomyopathy in tuscany.
   Am J Cardiol 2003 Dec 1;92(11):1358-62. (PubMed:14636924)
6. Capek P, Skvor J.
   Hypertrophic cardiomyopathy--molecular genetic analysis of exons 9 and 11 of the TNNT2 gene in Czech patients.
   Methods Inf Med. 2006; 45(2):169-72. (PubMed:16538283)
   • Glu163del is called "DeltaGlu160" in this report, and was found in one patient with severe HCM.

citations & disclaimer | contact us

Last modified: April 24, 2006