Project 3 > Mutation Database > TNNT2 mutations > Arg92Trp

The Arg92Trp mutation of human cardiac Troponin T

(other names:  R92W)

mutated amplimer sequence:
ggatcagggccctgcctgtcctggacaccctcagtccctgggtccagaat
ggggctgatgctgactattcctctctccaacaggtcgttcatgcccaact
tggtgcctcccaagatccccgatggagagagagtggactttgatgtaagc
ggtggctgtgggttgagtaggcctgggctggggatagtcccaagggccct
cagtgacagagattttgtgaccttgggctggggtagagcataggtgggat
ggggtgcagcaccagccaggctgggtgcccatccatgagcgtggtcctgg
gttcaggccacagttaccccttccctggccaggcgccaggccctgccaga
ggtcttttgcactgcgttggggggtgtctagcccacccatctctcctctg
gactctttggagtggcagcctctgagccgcagcggtccacccacaggaca
tccacTggaagcgcatggagaaggacctgaatgagttgcaggcgctgatc
gaggctcactttgagaacaggaagaaagaggaggagga

References and comments
1. Nakata et al., 1996. (abstract)
2. Moolman JC, Corfield VA, Posen B, Ngumbela K, Seidman C, Brink PA, Watkins H.
   Sudden death due to troponin T mutations.
   J Am Coll Cardiol 1997 Mar 1;29(3):549-55. (PubMed:9060892)
3. Moolman-Smook JC, De Lange WJ, Bruwer EC, Brink PA, Corfield VA.
   The origins of hypertrophic cardiomyopathy-causing mutations in two South African subpopulations: a unique profile of both independent and founder events.
   Am J Hum Genet 1999 Nov;65(5):1308-20. (PubMed:10521296)
4. Fujino N, Shimizu M, Ino H, Okeie K, Yamaguchi M, Yasuda T, Kokado H, Mabuchi H.
   Cardiac troponin T Arg92Trp mutation and progression from hypertrophic to dilated cardiomyopathy.
   Clin Cardiol 2001 May;24(5):397-402. (PubMed:11346248)
5. Varnava AM, Elliott PM, Baboonian C, Davison F, Davies MJ, McKenna WJ.
   Hypertrophic cardiomyopathy: histopathological features of sudden death in cardiac troponin T disease.
   Circulation. 2001 Sep 18;104(12):1380-4. (PubMed:11560853)
6. Palm T, Graboski S, Hitchcock-DeGregori SE, Greenfield NJ.
   Disease-causing mutations in cardiac troponin T: identification of a critical tropomyosin-binding region.
   Biophys J 2001 Nov;81(5):2827-37. (PubMed:11606294)
7. Waldmuller S, Freund P, Mauch S, Toder R, Vosberg HP.
   Low-density DNA microarrays are versatile tools to screen for known mutations in hypertrophic cardiomyopathy.
   Hum Mutat 2002 May;19(5):560-9. (PubMed:11968089)
8. Ackerman MJ, VanDriest SL, Ommen SR, Will ML, Nishimura RA, Tajik AJ, Gersh BJ.
   Prevalence and age-dependence of malignant mutations in the beta-myosin heavy chain and troponin T genes in hypertrophic cardiomyopathy: a comprehensive outpatient perspective.
   J Am Coll Cardiol 2002 Jun 19;39(12):2042-8. (PubMed:12084606)
9. Van Driest SL, Ellsworth EG, Ommen SR, Tajik AJ, Gersh BJ, Ackerman MJ.
   Prevalence and spectrum of thin filament mutations in an outpatient referral population with hypertrophic cardiomyopathy.
   Circulation 2003 Jul 29;108(4):445-51. Epub 2003 Jul 14. (PubMed:12860912)
10. Shimizu M, Ino H, Yamaguchi M, Terai H, Uchiyama K, Inoue M, Ikeda M, Kawashima A, Mabuchi H.
    Autopsy findings in siblings with hypertrophic cardiomyopathy caused by Arg92Trp mutation in the cardiac troponin T gene showing dilated cardiomyopathy-like features.
    Clin Cardiol 2003 Nov;26(11):536-9. (PubMed:14640471)
11. Moore, Seidman et al., 2004. (this study)
12. Konno T, Shimizu M, Ino H, Fujino N, Hayashi K, Uchiyama K, Kaneda T, Inoue M, Masuda E, Mabuchi H.
    Phenotypic differences between electrocardiographic and echocardiographic determination of hypertrophic cardiomyopathy in genetically affected subjects.
    J Intern Med. 2005 Sep;258(3):216-24. (PubMed:16115294)

citations & disclaimer | contact us

Last modified: April 24, 2006