Project 3 > Mutation Database > TNNT2 mutations > Arg278Cys

The Arg278Cys mutation of human cardiac Troponin T

(other names:  R278C)

mutated amplimer sequence:
gggggtgaaatgtggggcggagaagcttccctccagcctcaggctgctgt
cctattctgcccctggaggcagctccagcctgctcctctcccctttggca
ccccagtcctaccccagccgcatggtgacctactaccctgcctgtgtctc
catgtcactgcgtcctgcttcccctgcagctccaagaccTgcgggaaggc
taaagtcaccgggcgctggaaatagagcctggcctccttcaccaaagatc
tgctcctcgctcgcacctgcctccggcctgcactcccccagttcccgggc
cctcctgggcaccccaggcagctcctgtttggaaatggggagctggccta
ggtgggagccaccactcctgcctgcccccacac

References and comments
1. Watkins H, McKenna WJ, Thierfelder L, Suk HJ, Anan R, O'Donoghue A, Spirito P, Matsumori A, Moravec CS, Seidman JG, et al..
   Mutations in the genes for cardiac troponin T and alpha-tropomyosin in hypertrophic cardiomyopathy.
   N Engl J Med 1995 Apr 20;332(16):1058-64. (PubMed:7898523)
2. Yanaga F, Morimoto S, Ohtsuki I.
   Ca2+ sensitization and potentiation of the maximum level of myofibrillar ATPase activity caused by mutations of troponin T found in familial hypertrophic cardiomyopathy.
   J Biol Chem 1999 Mar 26;274(13):8806-12. (PubMed:10085122)
3. Elliott PM, D'Cruz L, McKenna WJ.
   Late-onset hypertrophic cardiomyopathy caused by a mutation in the cardiac troponin T gene.
   N Engl J Med 1999 Dec 9;341(24):1855-6. (PubMed:10610467)
4. Barr, Seidman et al., 2002. (this study)
5. Moore, Seidman et al., 2003. (this study)
6. Van Driest SL, Ellsworth EG, Ommen SR, Tajik AJ, Gersh BJ, Ackerman MJ.
   Prevalence and spectrum of thin filament mutations in an outpatient referral population with hypertrophic cardiomyopathy.
   Circulation 2003 Jul 29;108(4):445-51. Epub 2003 Jul 14. (PubMed:12860912)
7. Garcia-Castro M, Reguero JR, Batalla A, Diaz-Molina B, Gonzalez P, Alvarez V, Cortina A, Cubero GI, Coto E.
   Hypertrophic cardiomyopathy: low frequency of mutations in the beta-myosin heavy chain (MYH7) and cardiac troponin T (TNNT2) genes among Spanish patients.
   Clin Chem 2003 Aug;49(8):1279-85. (PubMed:12881443)
8. Garcia-Castro M, Reguero JR, Batalla A, Catalan F, Mayordomo J, Coto E.
   [Direct detection of malignant mutations in patients with hypertrophic cardiomyopathy]
   Rev Esp Cardiol 2003 Oct;56(10):1022-5. (PubMed:14563299)
9. Torricelli F, Girolami F, Olivotto I, Passerini I, Frusconi S, Vargiu D, Richard P, Cecchi F.
   Prevalence and clinical profile of troponin T mutations among patients with hypertrophic cardiomyopathy in tuscany.
   Am J Cardiol 2003 Dec 1;92(11):1358-62. (PubMed:14636924)
10. Moore, Seidman et al., 2004. (this study)
11. Theopistou A, Anastasakis A, Miliou A, Rigopoulos A, Toutouzas P, Stefanadis C.
    Clinical features of hypertrophic cardiomyopathy caused by an Arg278Cys missense mutation in the cardiac troponin T gene.
    Am J Cardiol 2004 Jul 15;94(2):246-9. (PubMed:15246915)
12. Miliou A, Anastasakis A, D'Cruz LG, Theopistou A, Rigopoulos A, Rizos I, Stamatelopoulos S, Toutouzas P, Stefanadis C.
    Low prevalence of cardiac troponin T mutations in a Greek hypertrophic cardiomyopathy cohort.
    Heart 2005 Jul;91(7):966-7. (PubMed:15958377)
13. Hernandez OM, Szczesna-Cordary D, Knollmann BC, Miller T, Bell M, Zhao J, Sirenko SG, Diaz Z, Guzman G, Xu Y, Wang Y, Kerrick WG, Potter JD.
    F110I and R278C troponin T mutations that cause familial hypertrophic cardiomyopathy affect muscle contraction in transgenic mice and reconstituted human cardiac fibers.
    J Biol Chem. 2005 Nov 4;280(44):37183-94. Epub 2005 Aug 22. (PubMed:16115869)
14. Ingles J, Doolan A, Chiu C, Seidman J, Seidman C, Semsarian C.
    Compound and double mutations in patients with hypertrophic cardiomyopathy: implications for genetic testing and counselling.
    J Med Genet. 2005 Oct;42(10):e59. (PubMed:16199542)

citations & disclaimer | contact us

Last modified: April 24, 2006