TNNT2 mutation Arg141Trp

The Arg141Trp mutation of human cardiac Troponin T

(other names: R141W, R471W (OMIM))

sequence
restriction enzyme
clinical information
references and comments

**SEQUENCE**
exon	10
nucleotide change	C>T
nucleotide pos. in gene	9733
UCSC Golden Path position	198065121
amino acid change	Arg>Trp
charge change	-1
codon change	CGG>TGG
transcript change	missense
translation change	substitution, non-conservative

mutated amplimer sequence:
acgtccgtggagctggttgaaagtggaggcccttggaggccgggcaccat
tgcttcaagactctggaaggaaccctcccccaggaattcccttgccaccc
catgcaggtttctgtacctgcgatgtcaccttctccctatgcacacctgg
gtgggctttgcctcttctccttaggagagacgtcgggcagagcgggccga
gcagcagcgcatcTggaatgagcgggagaaggagcggcagaaccgcctgg
ctgtgagtgacccctagcccaggcccatggaggccccccatgctcccagc
tcctgctgggcccccaggcccctctctattcatcaacatgaatgaaatca
gtcaagagacaatattggccggg

**RESTRICTION ENZYME**
restriction enzyme	Hpa II site lost

disease	DCM
clinical consequences	Age of onset and severity are highly variable. Incomplete penetrance.

References and comments

Li D, Czernuszewicz GZ, Gonzalez O, Tapscott T, Karibe A, Durand JB, Brugada R, Hill R, Gregoritch JM, Anderson JL, Quinones M, Bachinski LL, Roberts R.
Novel cardiac troponin T mutation as a cause of familial dilated cardiomyopathy.
Circulation 2001 Oct 30;104(18):2188-93. (PubMed:11684629)
- R141W found in all 14 affected family members tested. Not found in 100 normal control individuals or in 219 HCM probands.
Venkatraman G, Harada K, Gomes AV, Kerrick WG, Potter JD.
Different functional properties of troponin T mutants that cause dilated cardiomyopathy.
J Biol Chem 2003 Oct 24;278(43):41670-6. Epub 2003 Aug 14. (PubMed:12923187)
Villard E, Duboscq-Bidot L, Charron P, Benaiche A, Conraads V, Sylvius N, Komajda M.
Mutation screening in dilated cardiomyopathy: prominent role of the beta myosin heavy chain gene.
Eur Heart J 2005 Apr;26(8):794-803. Epub 2005 Mar 15. (PubMed:15769782)
- de novo mutation, DCM.

citations & disclaimer | contact us

Last modified: April 24, 2006