TNNI3 mutation Ile195Met

The Ile195Met mutation of human cardiac Troponin I

(other names: I195M)

sequence
restriction enzyme
clinical information
references and comments

**SEQUENCE**
exon	8
nucleotide change	C>G
nucleotide pos. in gene	6477
UCSC Golden Path position	60355062
amino acid change	Ile>Met
charge change	0
codon change	ATC>ATG
transcript change	missense
translation change	substitution

mutated amplimer sequence:
tggggaaaattggcagggattatcttgaaaagacaggaagtgctccagaa
ctagatacttaggcatccagggtagagtggccccacaggctggagggaag
acagggattcttgagagactggagaccaagaagagaccctaacctctgac
tcatcgccatcctccaggaaaaccgggaggtgggagactggcgcaagaac
atGgatgcactgagtggaatggagggccgcaagaaaaagtttgagagctg
agccttcctgcctactgcccctgccctgaggagg

**RESTRICTION ENZYME**
restriction enzyme	Cla I site lost
fragment sizes, wild-type strand (bp)	202, 82
fragment sizes, mutant strand (bp)	282

disease	HCM

Date this novel mutation was originally posted on this website: 9/28/2001

References and comments

Barr, Seidman et al., 2001. (this study)

Clinical features of individuals in this study having the TNNI3:Ile195Met mutation.
pedigree	sex	height (in.)	weight (lb.)	age of onset	age at exam	NYHA Class	LVWT, mm.	LVED	LVES	LA	EF, %	diagnosis
IH		70	135	30	58	IIII	9	42	22	54	50	HCM
IH		73	140	27	28		7	42	28	46		HCM

citations & disclaimer | contact us

Last modified: April 24, 2006