Project 3 > Mutation Database > TNNI3 mutations > Asp196Asn

The Asp196Asn mutation of human cardiac Troponin I

(other names:  D196N)

SEQUENCE
exon 8
nucleotide change G>A
nucleotide pos. in gene 6478
UCSC Golden Path position 60355061
amino acid changeAsp>Asn
charge change +1
codon change GAT>AAT
transcript change missense
translation change substitution


mutated amplimer sequence:
tggggaaaattggcagggattatcttgaaaagacaggaagtgctccagaa
ctagatacttaggcatccagggtagagtggccccacaggctggagggaag
acagggattcttgagagactggagaccaagaagagaccctaacctctgac
tcatcgccatcctccaggaaaaccgggaggtgggagactggcgcaagaac
atcAatgcactgagtggaatggagggccgcaagaaaaagtttgagagctg
agccttcctgcctactgcccctgccctgaggagg


RESTRICTION ENZYME
restriction enzyme Cla I site lost

 
disease HCM
clinical consequenceselderly-onset

 
    References and comments
  1. Niimura H, Patton KK, McKenna WJ, Soults J, Maron BJ, Seidman JG, Seidman CE.
    Sarcomere protein gene mutations in hypertrophic cardiomyopathy of the elderly.
    Circulation 2002 Jan 29;105(4):446-51. (PubMed:11815426)
  2. Richard P, Charron P, Carrier L, Ledeuil C, Cheav T, Pichereau C, Benaiche A, Isnard R, Dubourg O, Burban M, Gueffet JP, Millaire A, Desnos M, Schwartz K, Hainque B, Komajda M.
    Hypertrophic cardiomyopathy: distribution of disease genes, spectrum of mutations, and implications for a molecular diagnosis strategy.
    Circulation 2003 May 6;107(17):2227-32. Epub 2003 Apr 21. (PubMed:12707239)
  3. Mogensen J, Murphy RT, Kubo T, Bahl A, Moon JC, Klausen IC, Elliott PM, McKenna WJ.
    Frequency and clinical expression of cardiac troponin I mutations in 748 consecutive families with hypertrophic cardiomyopathy.
    J Am Coll Cardiol 2004 Dec 21;44(12):2315-25. (PubMed:15607392)
 

citations & disclaimer | contact us

Last modified: April 24, 2006