Project 3 > Mutation Database > TNNI3 mutations > Arg145Gly

The Arg145Gly mutation of human cardiac Troponin I

(other names:  R145G, R144G)

mutated amplimer sequence:
gcctaagccgggaagagactggtaaggcctcggtactggaagacgagata
aggagaataaaaaaggagtgtaggatggaggagttgggtgtgcgggaaat
ggaaggagaagtacccaccccctcgtgtgcccccagattgcagatctgac
tcagaagatctttgaccttcgaggcaagtttaagcggcccaccctgGgga
gagtgaggatctctgcagatgccatgatgcaggcgctgctgggggcccgg
gctaaggagtccctggacctgcgggcccacctcaagcaggtgaagaagga
ggacaccgagaaggtgagtgtgggctaaggccaggaaagaggatgctgag
gggaagggctgtgggtgccaacaaccctaggcctgagggcagatggtgct
tggagttggaggtagaagcagctagtaaggggtcctc

References and comments
1. Kimura A, Harada H, Park JE, Nishi H, Satoh M, Takahashi M, Hiroi S, Sasaoka T, Ohbuchi N, Nakamura T, Koyanagi T, Hwang TH, Choo JA, Chung KS, Hasegawa A, Nagai R, Okazaki O, Nakamura H, Matsuzaki M, Sakamoto T, Toshima H, Koga Y, Imaizumi T, Sasazuki T.
   Mutations in the cardiac troponin I gene associated with hypertrophic cardiomyopathy.
   Nat Genet 1997 Aug;16(4):379-82. (PubMed:9241277)
2. Takahashi-Yanaga F, Morimoto S, Ohtsuki I.
   Effect of Arg145Gly mutation in human cardiac troponin I on the ATPase activity of cardiac myofibrils.
   J Biochem (Tokyo) 2000 Mar;127(3):355-7. (PubMed:10731705)
3. Elliott K, Watkins H, Redwood CS.
   Altered regulatory properties of human cardiac troponin I mutants that cause hypertrophic cardiomyopathy.
   J Biol Chem 2000 Jul 21;275(29):22069-74. (PubMed:10806205)
4. Deng Y, Schmidtmann A, Redlich A, Westerdorf B, Jaquet K, Thieleczek R.
   Effects of phosphorylation and mutation R145G on human cardiac troponin I function.
   Biochemistry 2001 Dec 4;40(48):14593-602. (PubMed:11724573)
5. Takahashi-Yanaga F, Morimoto S, Harada K, Minakami R, Shiraishi F, Ohta M, Lu QW, Sasaguri T, Ohtsuki I.
   Functional consequences of the mutations in human cardiac troponin I gene found in familial hypertrophic cardiomyopathy.
   J Mol Cell Cardiol 2001 Dec;33(12):2095-107. (PubMed:11735257)
6. Lang R, Gomes AV, Zhao J, Housmans PR, Miller T, Potter JD.
   Functional analysis of a troponin I (R145G) mutation associated with familial hypertrophic cardiomyopathy.
   J Biol Chem 2002 Apr 5;277(14):11670-8. Epub 2002 Jan 18. (PubMed:11801593)
7. Burton D, Abdulrazzak H, Knott A, Elliott K, Redwood C, Watkins H, Marston S, Ashley C.
   Two mutations in troponin I that cause hypertrophic cardiomyopathy have contrasting effects on cardiac muscle contractility.
   Biochem J 2002 Mar 1;362(Pt 2):443-51. (PubMed:11853553)
8. Lindhout DA, Li MX, Schieve D, Sykes BD.
   Effects of T142 phosphorylation and mutation R145G on the interaction of the inhibitory region of human cardiac troponin I with the C-domain of human cardiac troponin C.
   Biochemistry 2002 Jun 11;41(23):7267-74. (PubMed:12044157)
9. Lindhout DA, Boyko RF, Corson DC, Li MX, Sykes BD.
   The role of electrostatics in the interaction of the inhibitory region of troponin I with troponin C.
   Biochemistry. 2005 Nov 15;44(45):14750-9. (PubMed:16274223)
   • Shown on (partial) crystal structure.

citations & disclaimer | contact us

Last modified: April 24, 2006