Project 3 > Mutation Database > MYL2 mutations > Phe18Leu

The Phe18Leu mutation of human cardiac Regulatory Myosin Light Chain

(other names:  F18L)

mutated amplimer sequence:
cacccagagtaggggcctgacctagttttttgactcccagcctctcactc
ttttaatcgatgcttttttcccccaggcacctaagaaagcaaagaagaga
gccgggggcgccaactccaacgtgCtctccatgttcgaacagacccaaat
ccaggaatttaaggaggtgggtgcagctattgaatcatccgcctggatgg
aaatcccacccacgagggagaaccttctttttgttccatattcccagcag
ggacctttcattagatgcctctatcctccaaacaatcccaaattcggcct
gaa

References and comments
1. Flavigny J, Richard P, Isnard R, Carrier L, Charron P, Bonne G, Forissier JF, Desnos M, Dubourg O, Komajda M, Schwartz K, Hainque B.
   Identification of two novel mutations in the ventricular regulatory myosin light chain gene (MYL2) associated with familial and classical forms of hypertrophic cardiomyopathy.
   J Mol Med 1998 Mar;76(3-4):208-14. (PubMed:9535554)
   • No mid-ventricular obstruction seen.
2. Szczesna D, Ghosh D, Li Q, Gomes AV, Guzman G, Arana C, Zhi G, Stull JT, Potter JD.
   Familial hypertrophic cardiomyopathy mutations in the regulatory light chains of myosin affect their structure, Ca2+ binding, and phosphorylation.
   J Biol Chem 2001 Mar 9;276(10):7086-92. Epub 2000 Dec 1. (PubMed:11102452)
3. Richard P, Charron P, Carrier L, Ledeuil C, Cheav T, Pichereau C, Benaiche A, Isnard R, Dubourg O, Burban M, Gueffet JP, Millaire A, Desnos M, Schwartz K, Hainque B, Komajda M.
   Hypertrophic cardiomyopathy: distribution of disease genes, spectrum of mutations, and implications for a molecular diagnosis strategy.
   Circulation 2003 May 6;107(17):2227-32. Epub 2003 Apr 21. (PubMed:12707239)
4. Szczesna-Cordary D, Guzman G, Ng SS, Zhao J.
   Familial hypertrophic cardiomyopathy-linked alterations in Ca2+ binding of human cardiac myosin regulatory light chain affect cardiac muscle contraction.
   J Biol Chem 2004 Jan 30;279(5):3535-42. Epub 2003 Nov 1. (PubMed:14594949)

citations & disclaimer | contact us

Last modified: April 24, 2006