Project 3 > Mutation Database > MYL2 mutations > Asn47Lys

The Asn47Lys mutation of human cardiac Regulatory Myosin Light Chain

(other names:  N47K)

SEQUENCE
exon 3
nucleotide change C>A
nucleotide pos. in gene 4938
UCSC Golden Path position 109816267
amino acid changeAsn>Lys
charge change +1
codon change  
transcript change missense
translation change substitution


mutated amplimer sequence:
ggcctgacgttttgaagaaactgttggattatcttcaattgttgactttt
aatctgaggtcctacaatgatctttgaagatcccagaatccactcctgcc
aagtccttggcccaatctcttgggcaactctgccagtttctcccaggctg
agctgccaatcacttcccttccacaggccttcactatcatggaccagaac
agggatggcttcattgacaagaaAgatctgagagacacctttgctgccct
tggtatgtcaccctctctagccctgcatgagggtctctttatctcacatc
catgaggagcaggaggtgggaccatcagaaaagctcaagatggtgtcatt
tcccaaagaaacaactctgccacaactggtctttaagacaaatttcaggg
gatggga


RESTRICTION ENZYME
no information

 
disease HCM
clinical consequencesmid-ventricular thickening

 
    References and comments
  1. Andersen et al., 1999. (abstract)
  2. Andersen PS, Havndrup O, Bundgaard H, Moolman-Smook JC, Larsen LA, Mogensen J, Brink PA, Borglum AD, Corfield VA, Kjeldsen K, Vuust J, Christiansen M.
    Myosin light chain mutations in familial hypertrophic cardiomyopathy: phenotypic presentation and frequency in Danish and South African populations.
    J Med Genet. 2001 Dec;38(12):E43. (PubMed:11748309)
  3. Arad, Seidman et al., 2003. (this study)
  4. Szczesna-Cordary D, Guzman G, Ng SS, Zhao J.
    Familial hypertrophic cardiomyopathy-linked alterations in Ca2+ binding of human cardiac myosin regulatory light chain affect cardiac muscle contraction.
    J Biol Chem 2004 Jan 30;279(5):3535-42. Epub 2003 Nov 1. (PubMed:14594949)
  5. Hougs L, Havndrup O, Bundgaard H, Kober L, Vuust J, Larsen LA, Christiansen M, Andersen PS.
    One third of Danish hypertrophic cardiomyopathy patients with MYH7 mutations have mutations [corrected] in MYH7 rod region.
    Eur J Hum Genet 2005 Feb;13(2):161-5. (PubMed:15483641)


Clinical features of individuals in this study having the MYL2:Asn47Lys mutation.
pedigree sex height (in.) weight (lb.) age of onset age at exam NYHA Class LVWT, mm. LVED LVES LA EF, % diagnosis
IE M           14 48   33 70 HCM

citations & disclaimer | contact us

Last modified: April 24, 2006