Project 3 > Mutation Database > MYL2 mutations > Ala13Thr

The Ala13Thr mutation of human cardiac Regulatory Myosin Light Chain

(other names:  A13T)

SEQUENCE
exon 2
nucleotide change G>A
nucleotide pos. in gene 1521
UCSC Golden Path position 109819684
amino acid changeAla>Thr
charge change 0
codon change  
transcript change missense
translation change substitution, non-conservative


mutated amplimer sequence:
cacccagagtaggggcctgacctagttttttgactcccagcctctcactc
ttttaatcgatgcttttttcccccaggcacctaagaaagcaaagaagaga
gccgggggcAccaactccaacgtgttctccatgttcgaacagacccaaat
ccaggaatttaaggaggtgggtgcagctattgaatcatccgcctggatgg
aaatcccacccacgagggagaaccttctttttgttccatattcccagcag
ggacctttcattagatgcctctatcctccaaacaatcccaaattcggcct
gaa


RESTRICTION ENZYME
no information

 
disease HCM
clinical consequencesmid-ventricular thickening

 
    References and comments
  1. Poetter K, Jiang H, Hassanzadeh S, Master SR, Chang A, Dalakas MC, Rayment I, Sellers JR, Fananapazir L, Epstein ND.
    Mutations in either the essential or regulatory light chains of myosin are associated with a rare myopathy in human heart and skeletal muscle.
    Nat Genet 1996 May;13(1):63-9. (PubMed:8673105)
  2. Andersen et al., 1999. (abstract)
  3. Szczesna D, Ghosh D, Li Q, Gomes AV, Guzman G, Arana C, Zhi G, Stull JT, Potter JD.
    Familial hypertrophic cardiomyopathy mutations in the regulatory light chains of myosin affect their structure, Ca2+ binding, and phosphorylation.
    J Biol Chem 2001 Mar 9;276(10):7086-92. Epub 2000 Dec 1. (PubMed:11102452)
  4. Andersen PS, Havndrup O, Bundgaard H, Moolman-Smook JC, Larsen LA, Mogensen J, Brink PA, Borglum AD, Corfield VA, Kjeldsen K, Vuust J, Christiansen M.
    Myosin light chain mutations in familial hypertrophic cardiomyopathy: phenotypic presentation and frequency in Danish and South African populations.
    J Med Genet. 2001 Dec;38(12):E43. (PubMed:11748309)
  5. Szczesna-Cordary D, Guzman G, Ng SS, Zhao J.
    Familial hypertrophic cardiomyopathy-linked alterations in Ca2+ binding of human cardiac myosin regulatory light chain affect cardiac muscle contraction.
    J Biol Chem 2004 Jan 30;279(5):3535-42. Epub 2003 Nov 1. (PubMed:14594949)
  6. Hougs L, Havndrup O, Bundgaard H, Kober L, Vuust J, Larsen LA, Christiansen M, Andersen PS.
    One third of Danish hypertrophic cardiomyopathy patients with MYH7 mutations have mutations [corrected] in MYH7 rod region.
    Eur J Hum Genet 2005 Feb;13(2):161-5. (PubMed:15483641)
 

citations & disclaimer | contact us

Last modified: April 24, 2006