Project 3 > Mutation Database > MYH7 mutations > Val606Met

The Val606Met mutation of human beta-cardiac Myosin Heavy Chain

(other names:  V606M)

mutated amplimer sequence:
ataactgtactcagagctgagcctactaccttaacacccaacatggcacc
tccacgagcaagtatattgaccatagagcagaatccatgtccacctgtgt
gaaggacactcagtgatgctctctcctgcttcctcagcccatgggcatca
tgtccatcctggaagaggagtgcatgttccccaaggccaccgacatgacc
ttcaaggccaagctgtttgacaaccacctgggcaaatccgccaacttcca
gaagccacgcaatatcaaggggaagcctgaagcccacttctccctgatcc
actatgccggcatcgtggactacaacatcattggctggctgcagaagaac
aaggatcctctcaatgagactgtcAtgggcttgtatcagaagtcttccct
caagctgctcagcaccctgtttgccaactatgctggggctgatgcgcgta
agtagggactgaggctcccggtacagaggagcagggattctgccaaggtt
ctgagccaggtcaattgctacaccccaccacttcaatgtcaggttgtacc
ccaaggtttacagactcagtgggatgga

References and comments
1. Watkins H, Rosenzweig A, Hwang DS, Levi T, McKenna W, Seidman CE, Seidman JG.
   Characteristics and prognostic implications of myosin missense mutations in familial hypertrophic cardiomyopathy.
   N Engl J Med 1992 Apr 23;326(17):1108-14. (PubMed:1552912)
2. Solomon et al., 1993. (PubMed:8335820)
3. Fananapazir L, Epstein ND.
   Genotype-phenotype correlations in hypertrophic cardiomyopathy. Insights provided by comparisons of kindreds with distinct and identical beta-myosin heavy chain gene mutations.
   Circulation 1994 Jan;89(1):22-32. (PubMed:8281650)
4. Marian AJ, Mares A Jr, Kelly DP, Yu QT, Abchee AB, Hill R, Roberts R.
   Sudden cardiac death in hypertrophic cardiomyopathy. Variability in phenotypic expression of beta-myosin heavy chain mutations.
   Eur Heart J 1995 Mar;16(3):368-76. (PubMed:7789380)
5. Nakajima-Taniguchi C, Azuma J, Nagata S, Kishimoto T, Yamauchi-Takihara K.
   A missense mutation in the beta-myosin heavy chain gene in a Japanese patient with hypertrophic cardiomyopathy.
   Jpn Circ J 1995 Dec;59(12):833-7. (PubMed:8788376)
   • Severe phenotype.
6. Abchee A, Marian AJ.
   Prognostic significance of beta-myosin heavy chain mutations is reflective of their hypertrophic expressivity in patients with hypertrophic cardiomyopathy.
   J Investig Med 1997 Apr;45(4):191-6. (PubMed:9154300)
7. Cuda G, Fananapazir L, Epstein ND, Sellers JR.
   The in vitro motility activity of beta-cardiac myosin depends on the nature of the beta-myosin heavy chain gene mutation in hypertrophic cardiomyopathy.
   J Muscle Res Cell Motil 1997 Jun;18(3):275-83. (PubMed:9172070)
8. Semsarian C, Yu B, Ryce C, Lawrence C, Washington H, Trent RJ.
   Sudden cardiac death in familial hypertrophic cardiomyopathy: are 'benign' mutations really benign?
   Pathology 1997 Aug;29(3):305-8. (PubMed:9271024)
9. Greber-Platzer S, Marx M, Fleischmann C, Suppan C, Dobner M, Wimmer M.
   Beta-myosin heavy chain gene mutations and hypertrophic cardiomyopathy in Austrian children.
   J Mol Cell Cardiol 2001 Jan;33(1):141-8. (PubMed:11133230)
10. Havndrup O, Bundgaard H, Andersen PS, Larsen LA, Vuust J, Kjeldsen K, Christiansen M.
    The Val606Met mutation in the cardiac beta-myosin heavy chain gene in patients with familial hypertrophic cardiomyopathy is associated with a high risk of sudden death at young age.
    Am J Cardiol 2001 Jun 1;87(11):1315-7. (PubMed:11377367)
11. Blair E, Price SJ, Baty CJ, Ostman-Smith I, Watkins H.
    Mutations in cis can confound genotype-phenotype correlations in hypertrophic cardiomyopathy.
    J Med Genet 2001 Jun;38(6):385-8. (PubMed:11424919)
    • compound heterozygote, with MYH7:Ala728Val
12. Havndrup O, Bundgaard H, Andersen PS, Allan Larsen L, Vuust J, Kjeldsen K, Christiansen M.
    Outcome of clinical versus genetic family screening in hypertrophic cardiomyopathy with focus on cardiac beta-myosin gene mutations.
    Cardiovasc Res 2003 Feb;57(2):347-57. (PubMed:12566107)
13. Richard P, Charron P, Carrier L, Ledeuil C, Cheav T, Pichereau C, Benaiche A, Isnard R, Dubourg O, Burban M, Gueffet JP, Millaire A, Desnos M, Schwartz K, Hainque B, Komajda M.
    Hypertrophic cardiomyopathy: distribution of disease genes, spectrum of mutations, and implications for a molecular diagnosis strategy.
    Circulation 2003 May 6;107(17):2227-32. Epub 2003 Apr 21. (PubMed:12707239)
14. Ingles J, Doolan A, Chiu C, Seidman J, Seidman C, Semsarian C.
    Compound and double mutations in patients with hypertrophic cardiomyopathy: implications for genetic testing and counselling.
    J Med Genet. 2005 Oct;42(10):e59. (PubMed:16199542)

citations & disclaimer | contact us

Last modified: April 24, 2006