MYH7 mutation Val186Leu

The Val186Leu mutation of human beta-cardiac Myosin Heavy Chain

(other names: V186L)

sequence
restriction enzyme
protein structure
clinical information
references and comments

**SEQUENCE**
exon	7
nucleotide change	G>C
nucleotide pos. in gene	7606
UCSC Golden Path position	22970893
amino acid change	Val>Leu
charge change	0
codon change	GTC>CTC
transcript change	missense
translation change	substitution

mutated amplimer sequence:
cttgctggtctccagtagtattgttcactgcccaataagcccctgtcttc
acagcggagaatccggagcagggaagacaCtcaacaccaagagggtcatc
cagtactttgctgttattgcagccattggggaccgcagcaagaaggacca
gagcccgggcaaggtaggcctgctgccctccaaggtcctgtaccgcag

**RESTRICTION ENZYME**
restriction enzyme	Hinc II site lost

disease	HCM

Date this novel mutation was originally posted on this website: 2/17/2004

References and comments

Gorham, Seidman et al., 2004. (this study)
Ingles J, Doolan A, Chiu C, Seidman J, Seidman C, Semsarian C.
Compound and double mutations in patients with hypertrophic cardiomyopathy: implications for genetic testing and counselling.
J Med Genet. 2005 Oct;42(10):e59. (PubMed:16199542)

citations & disclaimer | contact us

Last modified: April 24, 2006