MYH7 mutation Thr188Asn

The Thr188Asn mutation of human beta-cardiac Myosin Heavy Chain

(other names: T188N)

sequence
restriction enzyme
protein structure
clinical information
references and comments

**SEQUENCE**
exon	7
nucleotide change	C>A
nucleotide pos. in gene	7613
UCSC Golden Path position	22970886
amino acid change	Thr>Asn
charge change	0
codon change	ACC>AAC
transcript change	missense
translation change

mutated amplimer sequence:
cttgctggtctccagtagtattgttcactgcccaataagcccctgtcttc
acagcggagaatccggagcagggaagacagtcaacaAcaagagggtcatc
cagtactttgctgttattgcagccattggggaccgcagcaagaaggacca
gagcccgggcaaggtaggcctgctgccctccaaggtcctgtaccgcag

**RESTRICTION ENZYME**
no information

disease	HCM

References and comments

Richard P, Charron P, Carrier L, Ledeuil C, Cheav T, Pichereau C, Benaiche A, Isnard R, Dubourg O, Burban M, Gueffet JP, Millaire A, Desnos M, Schwartz K, Hainque B, Komajda M.
Hypertrophic cardiomyopathy: distribution of disease genes, spectrum of mutations, and implications for a molecular diagnosis strategy.
Circulation 2003 May 6;107(17):2227-32. Epub 2003 Apr 21. (PubMed:12707239)

citations & disclaimer | contact us

Last modified: April 24, 2006