Project 3 > Mutation Database > MYH7 mutations > Pro211Leu

The Pro211Leu mutation of human beta-cardiac Myosin Heavy Chain

(other names:  P211L)

SEQUENCE
exon 8
nucleotide change C>T
nucleotide pos. in gene 7682
UCSC Golden Path position 22970817
amino acid changePro>Leu
charge change 0
codon change CCG>CTG
transcript change missense
translation change substitution


mutated amplimer sequence:
cttgctggtctccagtagtattgttcactgcccaataagcccctgtcttc
acagcggagaatccggagcagggaagacagtcaacaccaagagggtcatc
cagtactttgctgttattgcagccattggggaccgcagcaagaaggacca
gagccTgggcaaggtaggcctgctgccctccaaggtcctgtaccgcag


RESTRICTION ENZYME
no information

 
disease HCM

 
    References and comments
  1. Mohiddin SA, Begley DA, McLam E, Cardoso JP, Winkler JB, Sellers JR, Fananapazir L.
    Utility of genetic screening in hypertrophic cardiomyopathy: prevalence and significance of novel and double (homozygous and heterozygous) beta-myosin mutations.
    Genet Test 2003 Spring;7(1):21-7. (PubMed:12820698)
  2. Woo A, Rakowski H, Liew JC, Zhao MS, Liew CC, Parker TG, Zeller M, Wigle ED, Sole MJ.
    Mutations of the beta myosin heavy chain gene in hypertrophic cardiomyopathy: critical functional sites determine prognosis.
    Heart 2003 Oct;89(10):1179-85. (PubMed:12975413)
  3. Perrot A, Schmidt-Traub H, Hoffmann B, Prager M, Bit-Avragim N, Rudenko RI, Usupbaeva DA, Kabaeva Z, Imanov B, Mirrakhimov MM, Dietz R, Wycisk A, Tendera M, Gessner R, Osterziel KJ.
    Prevalence of cardiac beta-myosin heavy chain gene mutations in patients with hypertrophic cardiomyopathy.
    J Mol Med 2005 Jun;83(6):468-477. Epub 2005 Apr 22. (PubMed:15856146)
 

citations & disclaimer | contact us

Last modified: April 24, 2006