MYH7 mutation Lys383Asn

The Lys383Asn mutation of human beta-cardiac Myosin Heavy Chain

(other names: K383N, Lys382Asn)

sequence
restriction enzyme
protein structure
clinical information
references and comments

**SEQUENCE**
exon	13
nucleotide change	G>T
nucleotide pos. in exon	11
nucleotide pos. in gene	10105
UCSC Golden Path position	22968386
amino acid change	LysÝAsn
charge change
codon change	AAG>AAT
transcript change	missense
translation change	substitution

mutated amplimer sequence:
agtcatctctttaccaactttgctacttgccttttccttccagaggctga
caaTtctgcctacctcatggggctgaactcagccgacctgctcaaggggc
tgtgccaccctcgggtgaaagtgggcaatgagtacgtcaccaaggggcag
aatgtccagcaggtgggtccatcttcagatgataat

**RESTRICTION ENZYME**
restriction enzyme	Tsp509 I site gained
fragment sizes, wild-type strand (bp)	186
fragment sizes, mutant strand (bp)	54, 132

disease	HCM

References and comments

Kuang SQ, Yu JD, Lu L, He LM, Gong LS, Chen SJ, Chen Z.
Identification of a novel missense mutation in the cardiac beta-myosin heavy chain gene in a Chinese patient with sporadic hypertrophic cardiomyopathy.
J Mol Cell Cardiol 1996 Sep;28(9):1879-83. (PubMed:8899546)
- De novo mutation in one Chinese HCM patient.

citations & disclaimer | contact us

Last modified: April 24, 2006