Project 3 >
Mutation Database >
MYH7 mutations >
Lys207Gln
(other names: K207Q)
SEQUENCE
| exon |
7 |
|---|
| nucleotide change | A>C |
|---|
| nucleotide pos. in
gene |
7669 |
|---|
| UCSC Golden Path position |
22970830 |
|---|
| amino acid change | Lys>Gln |
|---|
| charge change |
-1 |
|---|
| codon change |
AAG>CAG |
|---|
| transcript change |
missense |
|---|
| translation change |
|
|---|
mutated amplimer sequence:
cttgctggtctccagtagtattgttcactgcccaataagcccctgtcttc
acagcggagaatccggagcagggaagacagtcaacaccaagagggtcatc
cagtactttgctgttattgcagccattggggaccgcagcaagCaggacca
gagcccgggcaaggtaggcctgctgccctccaaggtcctgtaccgcag
References and comments
- Mohiddin SA, Begley DA, McLam E, Cardoso JP, Winkler JB, Sellers JR, Fananapazir L.
Utility of genetic screening in hypertrophic cardiomyopathy: prevalence and significance of novel and double (homozygous and heterozygous) beta-myosin mutations.
Genet Test 2003 Spring;7(1):21-7. (PubMed:12820698)
- K207Q homozygote, apical hypertrophy, diagnosed at age 47. A heterozygous sibling was diagnosed with HCM at age 80. Three heterozygous children (40Ős) had normal echos.
- Alpert NR, Mohiddin SA, Tripodi D, Jacobson-Hatzell J, Vaughn-Whitley K, Brosseau C, Warshaw DM, Fananapazir L.
Molecular and phenotypic effects of heterozygous, homozygous, and compound heterozygote myosin heavy-chain mutations.
Am J Physiol Heart Circ Physiol 2005 Mar;288(3):H1097-102. Epub 2004 Nov 4. (PubMed:15528230)
- severe phenotype in homozygous patient; mild phenotype in heterozygotes, with low penetrance.
citations & disclaimer |
contact us
Last modified: April 24, 2006