MYH7 mutation Leu390Val

The Leu390Val mutation of human beta-cardiac Myosin Heavy Chain

(other names: L390V)

sequence
restriction enzyme
protein structure
clinical information
references and comments

**SEQUENCE**
exon	13
nucleotide change	del CTG, ins GTT
nucleotide pos. in exon	21
nucleotide pos. in gene	10124..10126
UCSC Golden Path position	22968367..22968365
amino acid change	LeuÝVal
charge change
codon change	CTG>GTT
transcript change	deletion & insertion
translation change	substitution

mutated amplimer sequence:
agtcatctctttaccaactttgctacttgccttttccttccagaggctga
caagtctgcctacGtcatggggctgaactcagccgacctgctcaaggggc
tgtgccaccctcgggtgaaagtgggcaatgagtacgtcaccaaggggcag
aatgtccagcaggtgggtccatcttcagatgataat

**RESTRICTION ENZYME**
no information

disease	HCM

References and comments

Andersen et al., 1999. (abstract)
Havndrup O, Bundgaard H, Andersen PS, Larsen LA, Vuust J, Kjeldsen K, Christiansen M.
A novel missense mutation, Leu390Val, in the cardiac beta-myosin heavy chain associated with pronounced septal hypertrophy in two families with hypertrophic cardiomyopathy.
Scand Cardiovasc J 2000 Dec;34(6):558-63. (PubMed:11214007)
- asymmetric septal hypertrophy; the "double point mutation" was confirmed to be a single allele.
Havndrup O, Bundgaard H, Andersen PS, Allan Larsen L, Vuust J, Kjeldsen K, Christiansen M.
Outcome of clinical versus genetic family screening in hypertrophic cardiomyopathy with focus on cardiac beta-myosin gene mutations.
Cardiovasc Res 2003 Feb;57(2):347-57. (PubMed:12566107)

citations & disclaimer | contact us

Last modified: April 24, 2006