Project 3 > Mutation Database > MYH7 mutations > Ile263Thr

The Ile263Thr mutation of human beta-cardiac Myosin Heavy Chain

(other names:  I263T, Ile263Trp)

mutated amplimer sequence:
gacaactcctcccgcttcgtgagtggtccctgaccttggccttgggactt
ggactggtggaggaatggtctcagatatgagccttcccccaactcatcac
cactctcttccatctctccaggggaaattcattcgaattcattttggggc
aacaggaaagttggcatctgcagacaCagagacctgtgagtgccatgaat
ctgctaggctcagcctaagctcacccttgctctagaccatctggtcttga
cctctctctctctcccctccctccctctgtt

References and comments
1. Tesson F, Dufour C, Moolman JC, Carrier L, al-Mahdawi S, Chojnowska L, Dubourg O, Soubrier E, Brink P, Komajda M, Guicheney P, Schwartz K, Feingold J.
   The influence of the angiotensin I converting enzyme genotype in familial hypertrophic cardiomyopathy varies with the disease gene mutation.
   J Mol Cell Cardiol. 1997 Feb;29(2):831-8. (PubMed:9140839)
   • "Ile263Trp" is a mistake.
2. Charron et al., 1998.
3. Tesson F, Richard P, Charron P, Mathieu B, Cruaud C, Carrier L, Dubourg O, Lautie N, Desnos M, Millaire A, Isnard R, Hagege AA, Bouhour JB, Bennaceur M, Hainque B, Guicheney P, Schwartz K, Komajda M.
   Genotype-phenotype analysis in four families with mutations in beta-myosin heavy chain gene responsible for familial hypertrophic cardiomyopathy.
   Hum Mutat 1998;12(6):385-92. (PubMed:9829907)
4. Richard P, Charron P, Carrier L, Ledeuil C, Cheav T, Pichereau C, Benaiche A, Isnard R, Dubourg O, Burban M, Gueffet JP, Millaire A, Desnos M, Schwartz K, Hainque B, Komajda M.
   Hypertrophic cardiomyopathy: distribution of disease genes, spectrum of mutations, and implications for a molecular diagnosis strategy.
   Circulation 2003 May 6;107(17):2227-32. Epub 2003 Apr 21. (PubMed:12707239)
5. Brito D, Richard P, Isnard R, Pipa J, Komajda M, Madeira H.
   Familial hypertrophic cardiomyopathy: the same mutation, different prognosis. Comparison of two families with a long follow-up.
   Rev Port Cardiol. 2003 Dec;22(12):1445-61. (PubMed:15008060)
6. Brito D, Richard P, Isnard R, Pipa J, Komajda M, Madeira H.
   Familial hypertrophic cardiomyopathy: the same mutation, different prognosis. Comparison of two families with a long follow-up.
   Rev Port Cardiol 2003 Dec;22(12):1445-61. (PubMed:15008060)
7. Brito D, Madeira H.
   Malignant mutations in hypertrophic cardiomyopathy: fact or fancy?
   Rev Port Cardiol. 2005 Sep;24(9):1137-46. (PubMed:16335287)

citations & disclaimer | contact us

Last modified: April 24, 2006