Project 3 > Mutation Database > MYH7 mutations > Gly256Glu

The Gly256Glu mutation of human beta-cardiac Myosin Heavy Chain

(other names:  G256E)

SEQUENCE
exon 9
nucleotide change G>A
nucleotide pos. in exon 35
nucleotide pos. in gene 8002
UCSC Golden Path position 22970496
amino acid changeGlyİGlu
charge change  
codon change GGA>GAA
transcript change missense
translation change substitution


mutated amplimer sequence:
gacaactcctcccgcttcgtgagtggtccctgaccttggccttgggactt
ggactggtggaggaatggtctcagatatgagccttcccccaactcatcac
cactctcttccatctctccaggggaaattcattcgaattcattttggggc
aacagAaaagttggcatctgcagacatagagacctgtgagtgccatgaat
ctgctaggctcagcctaagctcacccttgctctagaccatctggtcttga
cctctctctctctcccctccctccctctgtt


RESTRICTION ENZYME
no information

 
disease HCM

 
    References and comments
  1. Fananapazir L, Dalakas MC, Cyran F, Cohn G, Epstein ND.
    Missense mutations in the beta-myosin heavy-chain gene cause central core disease in hypertrophic cardiomyopathy.
    Proc Natl Acad Sci U S A 1993 May 1;90(9):3993-7. (PubMed:8483915)
  2. Fananapazir L, Epstein ND.
    Genotype-phenotype correlations in hypertrophic cardiomyopathy. Insights provided by comparisons of kindreds with distinct and identical beta-myosin heavy chain gene mutations.
    Circulation 1994 Jan;89(1):22-32. (PubMed:8281650)
  3. Cuda G, Fananapazir L, Epstein ND, Sellers JR.
    The in vitro motility activity of beta-cardiac myosin depends on the nature of the beta-myosin heavy chain gene mutation in hypertrophic cardiomyopathy.
    J Muscle Res Cell Motil 1997 Jun;18(3):275-83. (PubMed:9172070)
 

citations & disclaimer | contact us

Last modified: April 24, 2006