Project 3 > Mutation Database > MYH7 mutations > Glu483Lys

The Glu483Lys mutation of human beta-cardiac Myosin Heavy Chain

(other names:  E483K)

SEQUENCE
exon 15
nucleotide change G>A
nucleotide pos. in exon 40
nucleotide pos. in gene 10811
UCSC Golden Path position 22967680
amino acid changeGluİLys
charge change  
codon change GAG>AAG
transcript change missense
translation change substitution


mutated amplimer sequence:
actcacacccactttctgactgctcccacccctcatgccccctgcagttc
aacagctttgagcagctctgcatcaacttcaccaacAagaagctgcagca
gttcttcaaccaccacatgtttgtgctggagcaggaggagtacaagaagg
agggcatcgagtggacattcattgactttggcatggacctgcaggcctgc
attgacctcatcgagaaggtgcctctttggccttaccacctgaattc


RESTRICTION ENZYME
no information

 
disease HCM

 
    References and comments
  1. Richard P, Isnard R, Carrier L, Dubourg O, Donatien Y, Mathieu B, Bonne G, Gary F, Charron P, Hagege M, Komajda M, Schwartz K, Hainque B.
    Double heterozygosity for mutations in the beta-myosin heavy chain and in the cardiac myosin binding protein C genes in a family with hypertrophic cardiomyopathy.
    J Med Genet 1999 Jul;36(7):542-5. (PubMed:10424815)
  2. Richard P, Charron P, Carrier L, Ledeuil C, Cheav T, Pichereau C, Benaiche A, Isnard R, Dubourg O, Burban M, Gueffet JP, Millaire A, Desnos M, Schwartz K, Hainque B, Komajda M.
    Hypertrophic cardiomyopathy: distribution of disease genes, spectrum of mutations, and implications for a molecular diagnosis strategy.
    Circulation 2003 May 6;107(17):2227-32. Epub 2003 Apr 21. (PubMed:12707239)
 

citations & disclaimer | contact us

Last modified: April 24, 2006