Project 3 > Mutation Database > MYH7 mutations > Asn187Lys

The Asn187Lys mutation of human beta-cardiac Myosin Heavy Chain

(other names:  N187K)

SEQUENCE
exon 7
nucleotide change C>G
nucleotide pos. in exon 31
nucleotide pos. in gene 7611
UCSC Golden Path position 22970888
amino acid changeAsnİLys
charge change  
codon change AAC>AAG
transcript change missense
translation change substitution


mutated amplimer sequence:
cttgctggtctccagtagtattgttcactgcccaataagcccctgtcttc
acagcggagaatccggagcagggaagacagtcaaGaccaagagggtcatc
cagtactttgctgttattgcagccattggggaccgcagcaagaaggacca
gagcccgggcaaggtaggcctgctgccctccaaggtcctgtaccgcag


RESTRICTION ENZYME
restriction enzyme Hinc II site lost
fragment sizes, wild-type strand (bp) 82, 116
fragment sizes, mutant strand (bp) 198

 
disease HCM

 
    References and comments
  1. Marian AJ, Roberts R.
    Recent advances in the molecular genetics of hypertrophic cardiomyopathy.
    Circulation 1995 Sep 1;92(5):1336-47. (PubMed:7648684)
  2. Rayment I, Holden HM, Sellers JR, Fananapazir L, Epstein ND.
    Structural interpretation of the mutations in the beta-cardiac myosin that have been implicated in familial hypertrophic cardiomyopathy.
    Proc Natl Acad Sci U S A 1995 Apr 25;92(9):3864-8. (PubMed:7731997)
 

citations & disclaimer | contact us

Last modified: April 24, 2006