Project 3 > Mutation Database > MYH7 mutations > Arg453Cys

The Arg453Cys mutation of human beta-cardiac Myosin Heavy Chain

(other names:  R453C)

mutated amplimer sequence:
caagttcactcttcccaacaaccctgctcaatatgggtctctcctccacc
ttgcaggtgatatatgccactggggcactggccaaggcagtgtatgagag
gatgttcaactggatggtgacgcgcatcaatgccaccctggagaccaagc
agccaTgccagtacttcataggagtcctggacatcgctggcttcgagatc
ttcgatgtgagttgggacccctgggagtgggagaacaatcactcactcgc
tcccacat

References and comments
1. Watkins H, Rosenzweig A, Hwang DS, Levi T, McKenna W, Seidman CE, Seidman JG.
   Characteristics and prognostic implications of myosin missense mutations in familial hypertrophic cardiomyopathy.
   N Engl J Med 1992 Apr 23;326(17):1108-14. (PubMed:1552912)
   • Family B of Tanigawa, et al, Cell 1990, 62:991, was here shown to have the R453C mutation, hence TanigawaÕs alpha/beta MHC fusion gene is probably not disease-causing after all.
2. Watkins H, Thierfelder L, Anan R, Jarcho J, Matsumori A, McKenna W, Seidman JG, Seidman CE.
   Independent origin of identical beta cardiac myosin heavy-chain mutations in hypertrophic cardiomyopathy.
   Am J Hum Genet 1993 Dec;53(6):1180-5. (PubMed:8250038)
3. Solomon et al., 1993. (PubMed:8335820)
4. Ko YL, Chen JJ, Tang TK, Cheng JJ, Lin SY, Liou YC, Kuan P, Wu CW, Lien WP, Liew CC.
   Malignant familial hypertrophic cardiomyopathy in a family with a 453Arg-Cys mutation in the beta-myosin heavy chain gene: coexistence of sudden death and end-stage heart failure.
   Hum Genet. 1996 May;97(5):585-90. (PubMed:8655135)
5. Smart RV, Yu B, Le H, French JA, Richmond DR, Jeremy RW, Semsarian C, Cheung L, Ross DA, Trent RJ.
   DNA testing in familial hypertrophic cardiomyopathy: clinical and laboratory implications.
   Clin Genet 1996 Oct;50(4):169-75. (PubMed:9001794)
6. Forissier JF, Richard P, Briault S, Ledeuil C, Dubourg O, Charbonnier B, Carrier L, Moraine C, Bonne G, Komajda M, Schwartz K, Hainque B.
   First description of germline mosaicism in familial hypertrophic cardiomyopathy.
   J Med Genet 2000 Feb;37(2):132-4. (PubMed:10662815)
7. Greber-Platzer S, Marx M, Fleischmann C, Suppan C, Dobner M, Wimmer M.
   Beta-myosin heavy chain gene mutations and hypertrophic cardiomyopathy in Austrian children.
   J Mol Cell Cardiol 2001 Jan;33(1):141-8. (PubMed:11133230)
8. Ackerman MJ, VanDriest SL, Ommen SR, Will ML, Nishimura RA, Tajik AJ, Gersh BJ.
   Prevalence and age-dependence of malignant mutations in the beta-myosin heavy chain and troponin T genes in hypertrophic cardiomyopathy: a comprehensive outpatient perspective.
   J Am Coll Cardiol 2002 Jun 19;39(12):2042-8. (PubMed:12084606)
9. Richard P, Charron P, Carrier L, Ledeuil C, Cheav T, Pichereau C, Benaiche A, Isnard R, Dubourg O, Burban M, Gueffet JP, Millaire A, Desnos M, Schwartz K, Hainque B, Komajda M.
   Hypertrophic cardiomyopathy: distribution of disease genes, spectrum of mutations, and implications for a molecular diagnosis strategy.
   Circulation 2003 May 6;107(17):2227-32. Epub 2003 Apr 21. (PubMed:12707239)
10. Garcia-Castro M, Reguero JR, Batalla A, Diaz-Molina B, Gonzalez P, Alvarez V, Cortina A, Cubero GI, Coto E.
    Hypertrophic cardiomyopathy: low frequency of mutations in the beta-myosin heavy chain (MYH7) and cardiac troponin T (TNNT2) genes among Spanish patients.
    Clin Chem 2003 Aug;49(8):1279-85. (PubMed:12881443)
11. Nanni L, Pieroni M, Chimenti C, Simionati B, Zimbello R, Maseri A, Frustaci A, Lanfranchi G.
    Hypertrophic cardiomyopathy: two homozygous cases with 'typical' hypertrophic cardiomyopathy and three new mutations in cases with progression to dilated cardiomyopathy.
    Biochem Biophys Res Commun 2003 Sep 19;309(2):391-8. (PubMed:12951062)
    • HCM progresses to "burnt-out" DCM.
12. Woo A, Rakowski H, Liew JC, Zhao MS, Liew CC, Parker TG, Zeller M, Wigle ED, Sole MJ.
    Mutations of the beta myosin heavy chain gene in hypertrophic cardiomyopathy: critical functional sites determine prognosis.
    Heart 2003 Oct;89(10):1179-85. (PubMed:12975413)
13. Garcia-Castro M, Reguero JR, Batalla A, Catalan F, Mayordomo J, Coto E.
    [Direct detection of malignant mutations in patients with hypertrophic cardiomyopathy]
    Rev Esp Cardiol 2003 Oct;56(10):1022-5. (PubMed:14563299)
14. Van Driest SL, Jaeger MA, Ommen SR, Will ML, Gersh BJ, Tajik AJ, Ackerman MJ.
    Comprehensive analysis of the beta-myosin heavy chain gene in 389 unrelated patients with hypertrophic cardiomyopathy.
    J Am Coll Cardiol 2004 Aug 4;44(3):602-10. (PubMed:15358028)
    • double heterozygote, with TNNT2:IVS11-1G>A
15. Perrot A, Schmidt-Traub H, Hoffmann B, Prager M, Bit-Avragim N, Rudenko RI, Usupbaeva DA, Kabaeva Z, Imanov B, Mirrakhimov MM, Dietz R, Wycisk A, Tendera M, Gessner R, Osterziel KJ.
    Prevalence of cardiac beta-myosin heavy chain gene mutations in patients with hypertrophic cardiomyopathy.
    J Mol Med 2005 Jun;83(6):468-477. Epub 2005 Apr 22. (PubMed:15856146)

citations & disclaimer | contact us

Last modified: April 24, 2006