Project 3 > Mutation Database > MYH7 mutations > Arg403Trp

The Arg403Trp mutation of human beta-cardiac Myosin Heavy Chain

(other names:  R403W)

mutated amplimer sequence:
agtcatctctttaccaactttgctacttgccttttccttccagaggctga
caagtctgcctacctcatggggctgaactcagccgacctgctcaaggggc
tgtgccaccctTgggtgaaagtgggcaatgagtacgtcaccaaggggcag
aatgtccagcaggtgggtccatcttcagatgataat

References and comments
1. dbSNP: rs3218714 (Submitter: BRINCOR*)
• Found in HCM cohort (South African).
2. Dausse E, Komajda M, Fetler L, Dubourg O, Dufour C, Carrier L, Wisnewsky C, Bercovici J, Hengstenberg C, al-Mahdawi S, et al..
   Familial hypertrophic cardiomyopathy. Microsatellite haplotyping and identification of a hot spot for mutations in the beta-myosin heavy chain gene.
   J Clin Invest 1993 Dec;92(6):2807-13. (PubMed:8254035)
3. Moolman JC, Brink PA, Corfield VA.
   Identification of a new missense mutation at Arg403, a CpG mutation hotspot, in exon 13 of the beta-myosin heavy chain gene in hypertrophic cardiomyopathy.
   Hum Mol Genet 1993 Oct;2(10):1731-2. (PubMed:8268932)
4. al-Mahdawi S, Chamberlain S, Chojnowska L, Michalak E, Nihoyannopoulos P, Ryan M, Kusnierczyk B, French JA, Gilligan DM, Cleland J, et al..
   The electrocardiogram is a more sensitive indicator than echocardiography of hypertrophic cardiomyopathy in families with a mutation in the MYH7 gene.
   Br Heart J 1994 Aug;72(2):105-11. (PubMed:7848420)
5. Posen BM, Moolman JC, Corfield VA, Brink PA.
   Clinical and prognostic evaluation of familial hypertrophic cardiomyopathy in two South African families with different cardiac beta myosin heavy chain gene mutations.
   Br Heart J 1995 Jul;74(1):40-6. (PubMed:7662452)
6. Tesson F, Dufour C, Moolman JC, Carrier L, al-Mahdawi S, Chojnowska L, Dubourg O, Soubrier E, Brink P, Komajda M, Guicheney P, Schwartz K, Feingold J.
   The influence of the angiotensin I converting enzyme genotype in familial hypertrophic cardiomyopathy varies with the disease gene mutation.
   J Mol Cell Cardiol. 1997 Feb;29(2):831-8. (PubMed:9140839)
7. Charron et al., 1998.
   • R403W has mild phenotype.
8. Moolman-Smook JC, De Lange WJ, Bruwer EC, Brink PA, Corfield VA.
   The origins of hypertrophic cardiomyopathy-causing mutations in two South African subpopulations: a unique profile of both independent and founder events.
   Am J Hum Genet 1999 Nov;65(5):1308-20. (PubMed:10521296)
9. Barr, Seidman et al., 2001. (this study)
10. Richard P, Charron P, Carrier L, Ledeuil C, Cheav T, Pichereau C, Benaiche A, Isnard R, Dubourg O, Burban M, Gueffet JP, Millaire A, Desnos M, Schwartz K, Hainque B, Komajda M.
    Hypertrophic cardiomyopathy: distribution of disease genes, spectrum of mutations, and implications for a molecular diagnosis strategy.
    Circulation 2003 May 6;107(17):2227-32. Epub 2003 Apr 21. (PubMed:12707239)
11. Gorham, Seidman et al., 2004. (this study)
12. Perrot A, Schmidt-Traub H, Hoffmann B, Prager M, Bit-Avragim N, Rudenko RI, Usupbaeva DA, Kabaeva Z, Imanov B, Mirrakhimov MM, Dietz R, Wycisk A, Tendera M, Gessner R, Osterziel KJ.
    Prevalence of cardiac beta-myosin heavy chain gene mutations in patients with hypertrophic cardiomyopathy.
    J Mol Med 2005 Jun;83(6):468-477. Epub 2005 Apr 22. (PubMed:15856146)

citations & disclaimer | contact us

Last modified: April 24, 2006