Project 3 > Mutation Database > MYH7 mutations > Arg403Leu

The Arg403Leu mutation of human beta-cardiac Myosin Heavy Chain

(other names:  R403L)

mutated amplimer sequence:
agtcatctctttaccaactttgctacttgccttttccttccagaggctga
caagtctgcctacctcatggggctgaactcagccgacctgctcaaggggc
tgtgccaccctcTggtgaaagtgggcaatgagtacgtcaccaaggggcag
aatgtccagcaggtgggtccatcttcagatgataat

References and comments
1. Dausse E, Komajda M, Fetler L, Dubourg O, Dufour C, Carrier L, Wisnewsky C, Bercovici J, Hengstenberg C, al-Mahdawi S, et al..
   Familial hypertrophic cardiomyopathy. Microsatellite haplotyping and identification of a hot spot for mutations in the beta-myosin heavy chain gene.
   J Clin Invest 1993 Dec;92(6):2807-13. (PubMed:8254035)
   • Family was linked to chr 14 locus.
2. al-Mahdawi S, Chamberlain S, Chojnowska L, Michalak E, Nihoyannopoulos P, Ryan M, Kusnierczyk B, French JA, Gilligan DM, Cleland J, et al..
   The electrocardiogram is a more sensitive indicator than echocardiography of hypertrophic cardiomyopathy in families with a mutation in the MYH7 gene.
   Br Heart J 1994 Aug;72(2):105-11. (PubMed:7848420)
3. Tesson F, Dufour C, Moolman JC, Carrier L, al-Mahdawi S, Chojnowska L, Dubourg O, Soubrier E, Brink P, Komajda M, Guicheney P, Schwartz K, Feingold J.
   The influence of the angiotensin I converting enzyme genotype in familial hypertrophic cardiomyopathy varies with the disease gene mutation.
   J Mol Cell Cardiol. 1997 Feb;29(2):831-8. (PubMed:9140839)
4. Charron et al., 1998.
5. Richard P, Charron P, Carrier L, Ledeuil C, Cheav T, Pichereau C, Benaiche A, Isnard R, Dubourg O, Burban M, Gueffet JP, Millaire A, Desnos M, Schwartz K, Hainque B, Komajda M.
   Hypertrophic cardiomyopathy: distribution of disease genes, spectrum of mutations, and implications for a molecular diagnosis strategy.
   Circulation 2003 May 6;107(17):2227-32. Epub 2003 Apr 21. (PubMed:12707239)

citations & disclaimer | contact us

Last modified: April 24, 2006