Project 3 > Mutation Database > MYH7 mutations > Arg403Gln

The Arg403Gln mutation of human beta-cardiac Myosin Heavy Chain

(other names:  R403Q)

mutated amplimer sequence:
agtcatctctttaccaactttgctacttgccttttccttccagaggctga
caagtctgcctacctcatggggctgaactcagccgacctgctcaaggggc
tgtgccaccctcAggtgaaagtgggcaatgagtacgtcaccaaggggcag
aatgtccagcaggtgggtccatcttcagatgataat

References and comments
1. Jarcho JA, McKenna W, Pare JA, Solomon SD, Holcombe RF, Dickie S, Levi T, Donis-Keller H, Seidman JG, Seidman CE.
   Mapping a gene for familial hypertrophic cardiomyopathy to chromosome 14q1.
   N Engl J Med 1989 Nov 16;321(20):1372-8. (PubMed:2811944)
2. Geisterfer-Lowrance AA, Kass S, Tanigawa G, Vosberg HP, McKenna W, Seidman CE, Seidman JG.
   A molecular basis for familial hypertrophic cardiomyopathy: a beta cardiac myosin heavy chain gene missense mutation.
   Cell 1990 Sep 7;62(5):999-1006. (PubMed:1975517)
3. Solomon SD, Jarcho JA, McKenna W, Geisterfer-Lowrance A, Germain R, Salerni R, Seidman JG, Seidman CE.
   Familial hypertrophic cardiomyopathy is a genetically heterogeneous disease.
   J Clin Invest 1990 Sep;86(3):993-9. (PubMed:1975599)
4. Watkins H, Rosenzweig A, Hwang DS, Levi T, McKenna W, Seidman CE, Seidman JG.
   Characteristics and prognostic implications of myosin missense mutations in familial hypertrophic cardiomyopathy.
   N Engl J Med 1992 Apr 23;326(17):1108-14. (PubMed:1552912)
5. Epstein ND, Cohn GM, Cyran F, Fananapazir L.
   Differences in clinical expression of hypertrophic cardiomyopathy associated with two distinct mutations in the beta-myosin heavy chain gene. A 908Leu----Val mutation and a 403Arg----Gln mutation.
   Circulation 1992 Aug;86(2):345-52. (PubMed:1638703)
   • R403Q is highly penetrant and leads to severe disease presentation.
6. Solomon et al., 1993. (PubMed:8335820)
7. Fananapazir L, Dalakas MC, Cyran F, Cohn G, Epstein ND.
   Missense mutations in the beta-myosin heavy-chain gene cause central core disease in hypertrophic cardiomyopathy.
   Proc Natl Acad Sci U S A 1993 May 1;90(9):3993-7. (PubMed:8483915)
8. Cuda G, Fananapazir L, Zhu WS, Sellers JR, Epstein ND.
   Skeletal muscle expression and abnormal function of beta-myosin in hypertrophic cardiomyopathy.
   J Clin Invest 1993 Jun;91(6):2861-5. (PubMed:8514894)
9. Marian AJ, Kelly D, Mares A Jr, Fitzgibbons J, Caira T, Qun-Tao, Hill R, Perryman MB, Roberts R.
   A missense mutation in the beta myosin heavy chain gene is a predictor of premature sudden death in patients with hypertrophic cardiomyopathy.
   J Sports Med Phys Fitness. 1994 Mar;34(1):1-10. (PubMed:7934006)
10. Fananapazir L, Epstein ND.
    Genotype-phenotype correlations in hypertrophic cardiomyopathy. Insights provided by comparisons of kindreds with distinct and identical beta-myosin heavy chain gene mutations.
    Circulation 1994 Jan;89(1):22-32. (PubMed:8281650)
11. Marian AJ, Mares A Jr, Kelly DP, Yu QT, Abchee AB, Hill R, Roberts R.
    Sudden cardiac death in hypertrophic cardiomyopathy. Variability in phenotypic expression of beta-myosin heavy chain mutations.
    Eur Heart J 1995 Mar;16(3):368-76. (PubMed:7789380)
    • poor prognosis
12. Malinchik S, Cuda G, Podolsky RJ, Horowits R.
    Isometric tension and mutant myosin heavy chain content in single skeletal myofibers from hypertrophic cardiomyopathy patients.
    J Mol Cell Cardiol 1997 Feb;29(2):667-76. (PubMed:9140824)
13. Cuda G, Fananapazir L, Epstein ND, Sellers JR.
    The in vitro motility activity of beta-cardiac myosin depends on the nature of the beta-myosin heavy chain gene mutation in hypertrophic cardiomyopathy.
    J Muscle Res Cell Motil 1997 Jun;18(3):275-83. (PubMed:9172070)
14. Georgakopoulos D, Christe ME, Giewat M, Seidman CM, Seidman JG, Kass DA.
    The pathogenesis of familial hypertrophic cardiomyopathy: early and evolving effects from an alpha-cardiac myosin heavy chain missense mutation.
    Nat Med 1999 Mar;5(3):327-30. (PubMed:10086390)
15. Goncalves LM, Vieira M, Faro C, Ventura M, Pires E, Providencia LA.
    Identification of an Arg403Gln beta myosin heavy chain gene mutation in a Portuguese family with hypertrophic cardiomyopathy.
    Rev Port Cardiol 2000 Apr;19(4):431-43. (PubMed:10874840)
16. Barr, Seidman et al., 2001. (this study)
17. Waldmuller S, Freund P, Mauch S, Toder R, Vosberg HP.
    Low-density DNA microarrays are versatile tools to screen for known mutations in hypertrophic cardiomyopathy.
    Hum Mutat 2002 May;19(5):560-9. (PubMed:11968089)
18. Ackerman MJ, VanDriest SL, Ommen SR, Will ML, Nishimura RA, Tajik AJ, Gersh BJ.
    Prevalence and age-dependence of malignant mutations in the beta-myosin heavy chain and troponin T genes in hypertrophic cardiomyopathy: a comprehensive outpatient perspective.
    J Am Coll Cardiol 2002 Jun 19;39(12):2042-8. (PubMed:12084606)
19. Richard P, Charron P, Carrier L, Ledeuil C, Cheav T, Pichereau C, Benaiche A, Isnard R, Dubourg O, Burban M, Gueffet JP, Millaire A, Desnos M, Schwartz K, Hainque B, Komajda M.
    Hypertrophic cardiomyopathy: distribution of disease genes, spectrum of mutations, and implications for a molecular diagnosis strategy.
    Circulation 2003 May 6;107(17):2227-32. Epub 2003 Apr 21. (PubMed:12707239)
20. Mohiddin SA, Begley DA, McLam E, Cardoso JP, Winkler JB, Sellers JR, Fananapazir L.
    Utility of genetic screening in hypertrophic cardiomyopathy: prevalence and significance of novel and double (homozygous and heterozygous) beta-myosin mutations.
    Genet Test 2003 Spring;7(1):21-7. (PubMed:12820698)
21. Woo A, Rakowski H, Liew JC, Zhao MS, Liew CC, Parker TG, Zeller M, Wigle ED, Sole MJ.
    Mutations of the beta myosin heavy chain gene in hypertrophic cardiomyopathy: critical functional sites determine prognosis.
    Heart 2003 Oct;89(10):1179-85. (PubMed:12975413)
22. Van Driest SL, Jaeger MA, Ommen SR, Will ML, Gersh BJ, Tajik AJ, Ackerman MJ.
    Comprehensive analysis of the beta-myosin heavy chain gene in 389 unrelated patients with hypertrophic cardiomyopathy.
    J Am Coll Cardiol 2004 Aug 4;44(3):602-10. (PubMed:15358028)

citations & disclaimer | contact us

Last modified: April 24, 2006