Project 3 > Mutation Database > MYH7 mutations > Arg249Gln

The Arg249Gln mutation of human beta-cardiac Myosin Heavy Chain

(other names:  R249Q)

mutated amplimer sequence:
gacaactcctcccgcttcgtgagtggtccctgaccttggccttgggactt
ggactggtggaggaatggtctcagatatgagccttcccccaactcatcac
cactctcttccatctctccaggggaaattcattcAaattcattttggggc
aacaggaaagttggcatctgcagacatagagacctgtgagtgccatgaat
ctgctaggctcagcctaagctcacccttgctctagaccatctggtcttga
cctctctctctctcccctccctccctctgtt

References and comments
1. dbSNP: rs3218713 (Submitter: BRINCOR*)
• Found in HCM cohort (South African).
2. Rosenzweig A, Watkins H, Hwang DS, Miri M, McKenna W, Traill TA, Seidman JG, Seidman CE.
   Preclinical diagnosis of familial hypertrophic cardiomyopathy by genetic analysis of blood lymphocytes.
   N Engl J Med 1991 Dec 19;325(25):1753-60. (PubMed:1944483)
3. Watkins H, Rosenzweig A, Hwang DS, Levi T, McKenna W, Seidman CE, Seidman JG.
   Characteristics and prognostic implications of myosin missense mutations in familial hypertrophic cardiomyopathy.
   N Engl J Med 1992 Apr 23;326(17):1108-14. (PubMed:1552912)
4. Tesson F, Dufour C, Moolman JC, Carrier L, al-Mahdawi S, Chojnowska L, Dubourg O, Soubrier E, Brink P, Komajda M, Guicheney P, Schwartz K, Feingold J.
   The influence of the angiotensin I converting enzyme genotype in familial hypertrophic cardiomyopathy varies with the disease gene mutation.
   J Mol Cell Cardiol. 1997 Feb;29(2):831-8. (PubMed:9140839)
5. Arbustini E, Fasani R, Morbini P, Diegoli M, Grasso M, Dal Bello B, Marangoni E, Banfi P, Banchieri N, Bellini O, Comi G, Narula J, Campana C, Gavazzi A, Danesino C, Vigano M.
   Coexistence of mitochondrial DNA and beta myosin heavy chain mutations in hypertrophic cardiomyopathy with late congestive heart failure.
   Heart 1998 Dec;80(6):548-58. (PubMed:10065021)
   • R249Q found along with A4300G mutation in mitochondrial tRNAIle.
6. Moolman-Smook JC, De Lange WJ, Bruwer EC, Brink PA, Corfield VA.
   The origins of hypertrophic cardiomyopathy-causing mutations in two South African subpopulations: a unique profile of both independent and founder events.
   Am J Hum Genet 1999 Nov;65(5):1308-20. (PubMed:10521296)
7. Greber-Platzer S, Marx M, Fleischmann C, Suppan C, Dobner M, Wimmer M.
   Beta-myosin heavy chain gene mutations and hypertrophic cardiomyopathy in Austrian children.
   J Mol Cell Cardiol 2001 Jan;33(1):141-8. (PubMed:11133230)
8. Waldmuller S, Freund P, Mauch S, Toder R, Vosberg HP.
   Low-density DNA microarrays are versatile tools to screen for known mutations in hypertrophic cardiomyopathy.
   Hum Mutat 2002 May;19(5):560-9. (PubMed:11968089)
9. Richard P, Charron P, Carrier L, Ledeuil C, Cheav T, Pichereau C, Benaiche A, Isnard R, Dubourg O, Burban M, Gueffet JP, Millaire A, Desnos M, Schwartz K, Hainque B, Komajda M.
   Hypertrophic cardiomyopathy: distribution of disease genes, spectrum of mutations, and implications for a molecular diagnosis strategy.
   Circulation 2003 May 6;107(17):2227-32. Epub 2003 Apr 21. (PubMed:12707239)
10. Woo A, Rakowski H, Liew JC, Zhao MS, Liew CC, Parker TG, Zeller M, Wigle ED, Sole MJ.
    Mutations of the beta myosin heavy chain gene in hypertrophic cardiomyopathy: critical functional sites determine prognosis.
    Heart 2003 Oct;89(10):1179-85. (PubMed:12975413)

citations & disclaimer | contact us

Last modified: April 24, 2006