Project 3 > Mutation Database > MYH7 mutations > Arg190Thr

The Arg190Thr mutation of human beta-cardiac Myosin Heavy Chain

(other names:  R190T, Arg189Thr)

SEQUENCE
exon 7
nucleotide change G>C
nucleotide pos. in exon 37
nucleotide pos. in gene 7619
UCSC Golden Path position 22970880
amino acid changeArgİThr
charge change  
codon change AGG>ACG
transcript change missense
translation change substitution


mutated amplimer sequence:
cttgctggtctccagtagtattgttcactgcccaataagcccctgtcttc
acagcggagaatccggagcagggaagacagtcaacaccaagaCggtcatc
cagtactttgctgttattgcagccattggggaccgcagcaagaaggacca
gagcccgggcaaggtaggcctgctgccctccaaggtcctgtaccgcag


RESTRICTION ENZYME
restriction enzyme Mnl I site gained
fragment sizes, wild-type strand (bp) 187,11
fragment sizes, mutant strand (bp) 84,103,11

 
disease HCM

 
    References and comments
  1. Andersen et al., 1998. (abstract)
  2. Bundgaard H, Havndrup O, Andersen PS, Larsen LA, Brandt NJ, Vuust J, Kjeldsen K, Christiansen M.
    Familial hypertrophic cardiomyopathy associated with a novel missense mutation affecting the ATP-binding region of the cardiac beta-myosin heavy chain.
    J Mol Cell Cardiol 1999 Apr;31(4):745-50. (PubMed:10329202)
  3. Havndrup O, Bundgaard H, Andersen PS, Allan Larsen L, Vuust J, Kjeldsen K, Christiansen M.
    Outcome of clinical versus genetic family screening in hypertrophic cardiomyopathy with focus on cardiac beta-myosin gene mutations.
    Cardiovasc Res 2003 Feb;57(2):347-57. (PubMed:12566107)
 

citations & disclaimer | contact us

Last modified: April 24, 2006