Project 3 > Mutation Database > MYH7 mutations > Ala355Thr

The Ala355Thr mutation of human beta-cardiac Myosin Heavy Chain

(other names:  A355T)

SEQUENCE
exon 12
nucleotide change G>A
nucleotide pos. in exon 64
nucleotide pos. in gene 9601
UCSC Golden Path position 22968899
amino acid changeAlaİThr
charge change  
codon change GCC>ACC
transcript change missense
translation change substitution


mutated amplimer sequence:
cacagggattaaggagacaagttttctctccaacttacaagggatctcac
ttacccatcatacttctttttctggggtccgccaatatggggcctcccta
cagaacgcttttgatgtgctgggcttcacttcagaggagaaaaactccat
gtataagctgacaggcAccatcatgcactttggaaacatgaagttcaagc
tgaagcagcgggaggagcaggcggagccagacggcactgaaggtgggagg
caggattcttggggcagctgtaa


RESTRICTION ENZYME
restriction enzyme Cfo I

 
disease HCM

 

Date this novel mutation was originally posted on this website:   7/6/2001

    References and comments
  1. Barr, Seidman et al., 2001. (this study)
  2. Richard P, Charron P, Carrier L, Ledeuil C, Cheav T, Pichereau C, Benaiche A, Isnard R, Dubourg O, Burban M, Gueffet JP, Millaire A, Desnos M, Schwartz K, Hainque B, Komajda M.
    Hypertrophic cardiomyopathy: distribution of disease genes, spectrum of mutations, and implications for a molecular diagnosis strategy.
    Circulation 2003 May 6;107(17):2227-32. Epub 2003 Apr 21. (PubMed:12707239)


Clinical features of individuals in this study having the MYH7:Ala355Thr mutation.
pedigree sex height (in.) weight (lb.) age of onset age at exam NYHA Class LVWT, mm. LVED LVES LA EF, % diagnosis
EC M   195   50 II 17 45 31 77 65 HCM

citations & disclaimer | contact us

Last modified: April 24, 2006