Project 3 > Mutation Database > MYBPC3 mutations > Val896Met

The Val896Met mutation of human cardiac Myosin-Binding Protein C

(other names:  V896M)

mutated amplimer sequence:
ggaagtgccccctatgtgaccagtgggcagttcagagtctagggcatgga
tctccagcttccccaggcttgctcagacccctctctgacctctcctctgc
ccaggtccccccagcgaacccacccacctggcagtagaggacgtctctga
caccacggtctccctcaagtggcggcccccagagcgcAtgggagcaggag
gcctggatggctacagcgtggagtactgcccagagggctgtgagtgtccc
cgcccccaacccccctccccaaaggaagaacatgctcaccttgccattga
gcagattcacctgtagtcaagttttttaggcccacttttgccgaaagttg
aggacacccagagaaatatctgtcctgttttcagaagtaaaaaagcttgc
ctagtgaaaaacaaatgcagagtaaagctgactgtaacacttctttgagc
agtgcga

References and comments
1. Moolman-Smook JC, De Lange WJ, Bruwer EC, Brink PA, Corfield VA.
   The origins of hypertrophic cardiomyopathy-causing mutations in two South African subpopulations: a unique profile of both independent and founder events.
   Am J Hum Genet 1999 Nov;65(5):1308-20. (PubMed:10521296)
   • Found in a single subject with no family members available for study. Not seen in 100 normal control individuals from same ethnic group (South African "mixed ancestry").
2. Jaaskelainen P, Kuusisto J, Miettinen R, Karkkainen P, Karkkainen S, Heikkinen S, Peltola P, Pihlajamaki J, Vauhkonen I, Laakso M.
   Mutations in the cardiac myosin-binding protein C gene are the predominant cause of familial hypertrophic cardiomyopathy in eastern Finland.
   J Mol Med 2002 Jul;80(7):412-22. Epub 2002 Apr 11. (PubMed:12110947)
   • Called non-disease-causing, since 5 of 111 normal controls were hets, and since an unaffected parent was homozygous for V896M.
3. Richard P, Charron P, Carrier L, Ledeuil C, Cheav T, Pichereau C, Benaiche A, Isnard R, Dubourg O, Burban M, Gueffet JP, Millaire A, Desnos M, Schwartz K, Hainque B, Komajda M.
   Hypertrophic cardiomyopathy: distribution of disease genes, spectrum of mutations, and implications for a molecular diagnosis strategy.
   Circulation 2003 May 6;107(17):2227-32. Epub 2003 Apr 21. (PubMed:12707239)
   • double heterozygote, with MYH7:Ala355Thr
   • Pathogenicity unclear; may act as a modifier when another mutation is present (as seen in 3 individuals in one family). Found on its own in 3 HCM probands.
4. Morner S, Richard P, Kazzam E, Hellman U, Hainque B, Schwartz K, Waldenstrom A.
   Identification of the genotypes causing hypertrophic cardiomyopathy in northern Sweden.
   J Mol Cell Cardiol 2003 Jul;35(7):841-9. (PubMed:12818575)
   • double heterozygote, with MYH7:Glu924Lys
   • V896M seen in 3 of 100 healthy control subjects. No relatives of the V896M/E924K proband were available for genotyping.
5. Merk, Seidman et al., 2004. (this study)
6. Van Driest SL, Vasile VC, Ommen SR, Will ML, Tajik AJ, Gersh BJ, Ackerman MJ.
   Myosin binding protein C mutations and compound heterozygosity in hypertrophic cardiomyopathy.
   J Am Coll Cardiol 2004 Nov 2;44(9):1903-10. (PubMed:15519027)
   • Polymorphism.

citations & disclaimer | contact us

Last modified: April 24, 2006