Project 3 > Mutation Database > MYBPC3 mutations > IVS8+5G>A

The IVS8+5G>A mutation of human cardiac Myosin-Binding Protein C

(other names:  IVS7+5G>A, M1)

SEQUENCE
intron 8
nucleotide change G>A
nucleotide pos. in gene 5828
UCSC Golden Path position 47325979
charge change  
codon change  
transcript change splice donor site mutation
translation change  


mutated amplimer sequence:
gcttctcaaacggccccctctgaagccccttcccccatctctccaccctt
tgaacccagaggccatgggcaccggagacctggacctcctatcagccttc
cgccgcacgtgaAtggccatcctcagggcctgggggaggccagtgctgga
gtctgaggcccttcagggtctcgactgggggtcagggctggggatgattt
gcggggcggagct


RESTRICTION ENZYME
no information

 
disease HCM

 
    References and comments
  1. Carrier L, Bonne G, Bahrend E, Yu B, Richard P, Niel F, Hainque B, Cruaud C, Gary F, Labeit S, Bouhour JB, Dubourg O, Desnos M, Hagege AA, Trent RJ, Komajda M, Fiszman M, Schwartz K.
    Organization and sequence of human cardiac myosin binding protein C gene (MYBPC3) and identification of mutations predicted to produce truncated proteins in familial hypertrophic cardiomyopathy.
    Circ Res 1997 Mar;80(3):427-34. (PubMed:9048664)
  2. Flavigny J, Souchet M, Sebillon P, Berrebi-Bertrand I, Hainque B, Mallet A, Bril A, Schwartz K, Carrier L.
    COOH-terminal truncated cardiac myosin-binding protein C mutants resulting from familial hypertrophic cardiomyopathy mutations exhibit altered expression and/or incorporation in fetal rat cardiomyocytes.
    J Mol Biol. 1999 Nov 26;294(2):443-56. (PubMed:10610770)
  3. Richard P, Charron P, Carrier L, Ledeuil C, Cheav T, Pichereau C, Benaiche A, Isnard R, Dubourg O, Burban M, Gueffet JP, Millaire A, Desnos M, Schwartz K, Hainque B, Komajda M.
    Hypertrophic cardiomyopathy: distribution of disease genes, spectrum of mutations, and implications for a molecular diagnosis strategy.
    Circulation 2003 May 6;107(17):2227-32. Epub 2003 Apr 21. (PubMed:12707239)
  4. Flavigny J, Robert P, Camelin JC, Schwartz K, Carrier L, Berrebi-Bertrand I.
    Biomolecular interactions between human recombinant beta-MyHC and cMyBP-Cs implicated in familial hypertrophic cardiomyopathy.
    Cardiovasc Res 2003 Nov 1;60(2):388-96. (PubMed:14613868)
 

citations & disclaimer | contact us

Last modified: April 24, 2006