Project 3 > Mutation Database > MYBPC3 mutations > IVS24+1G>A

The IVS24+1G>A mutation of human cardiac Myosin-Binding Protein C

(other names:  IVS23+1G>A, Int24+1G>A)

SEQUENCE
intron 24
nucleotide change G>A
nucleotide pos. in gene 15131
UCSC Golden Path position 47316646
charge change  
codon change  
transcript change donor site mutation/ splicing defect
translation change  


mutated amplimer sequence:
tcggtgccacagagatgattttgaactagatgctgacgtggatgcagtct
tcccacaggctgtgttccccccatggacccccgggacatctggctgttgg
cggaggctgcaagggcctctggggtctgacttggatctcaccccaactct
gcacccccccagctgctgtgtgagaccgagggccgggtccgcgtggagac
caccaaggaccgcagcatcttcacggtcgagggggcagagaaggaagatg
agggcgtctacacggtcacagtgaagaaccctgtgggcgaggaccaggtc
aacctcacagtcaaggtcatcgAtgaggccggccggggtccaagctggag
aacacagaggggcagcc


RESTRICTION ENZYME
no information

 
disease HCM

 
    References and comments
  1. Barr, Seidman et al., 2001. (this study)
  2. Richard P, Charron P, Carrier L, Ledeuil C, Cheav T, Pichereau C, Benaiche A, Isnard R, Dubourg O, Burban M, Gueffet JP, Millaire A, Desnos M, Schwartz K, Hainque B, Komajda M.
    Hypertrophic cardiomyopathy: distribution of disease genes, spectrum of mutations, and implications for a molecular diagnosis strategy.
    Circulation 2003 May 6;107(17):2227-32. Epub 2003 Apr 21. (PubMed:12707239)
  3. Ingles J, Doolan A, Chiu C, Seidman J, Seidman C, Semsarian C.
    Compound and double mutations in patients with hypertrophic cardiomyopathy: implications for genetic testing and counselling.
    J Med Genet. 2005 Oct;42(10):e59. (PubMed:16199542)


Clinical features of individuals in this study having the MYBPC3:IVS24+1G>A mutation.
pedigree sex height (in.) weight (lb.) age of onset age at exam NYHA Class LVWT, mm. LVED LVES LA EF, % diagnosis
BO F   133   81   22 34 20 41   HCM
BO F 62 133   73   20 35 16 47 55 HCM
BO M 66 160   47   15 45 22 36   HCM
BO F   50   13   10 38 20 25   HCM
BO M 74 174   46   10 44 24 35   HCM
BO F 61     83   20 32 17 40 47 HCM

citations & disclaimer | contact us

Last modified: April 24, 2006