Project 3 > Mutation Database > MYBPC3 mutations > IVS24-26A>G

The IVS24-26A>G mutation of human cardiac Myosin-Binding Protein C

(other names:  a15829g)

mutated amplimer sequence:
cctgtggcggttagttggagtgggaaggggacgagcaacgttactcaagg
cctgagcggggcagggctgGtgtgggtccatcccaccccatccagacgtg
ccagacgcacctgcggcccccaagatcagcaacgtgggagaggactcctg
cacagtacagtgggagccgcctgcctacgatggcgggcagcccatcctgg
gtgagtgcaagggcaccggatggaggtgtgagggcgccaaacagatccga
gggaaggtggtgtggggatgcctgggttccagaccagagctgccacctcc
cctgagccaggctacatcctggagcgcaagaagaagaagagctaccggtg

References and comments
1. Carrier L, Bonne G, Bahrend E, Yu B, Richard P, Niel F, Hainque B, Cruaud C, Gary F, Labeit S, Bouhour JB, Dubourg O, Desnos M, Hagege AA, Trent RJ, Komajda M, Fiszman M, Schwartz K.
   Organization and sequence of human cardiac myosin binding protein C gene (MYBPC3) and identification of mutations predicted to produce truncated proteins in familial hypertrophic cardiomyopathy.
   Circ Res 1997 Mar;80(3):427-34. (PubMed:9048664)
   • Inactivates a potential branch point splice sequence (URAY). Aberrant cDNA splicing was demonstrated. Absent in 200 control samples.
2. Richard P, Charron P, Carrier L, Ledeuil C, Cheav T, Pichereau C, Benaiche A, Isnard R, Dubourg O, Burban M, Gueffet JP, Millaire A, Desnos M, Schwartz K, Hainque B, Komajda M.
   Hypertrophic cardiomyopathy: distribution of disease genes, spectrum of mutations, and implications for a molecular diagnosis strategy.
   Circulation 2003 May 6;107(17):2227-32. Epub 2003 Apr 21. (PubMed:12707239)

citations & disclaimer | contact us

Last modified: April 24, 2006