Project 3 > Mutation Database > MYBPC3 mutations > IVS21-2A>G

The IVS21-2A>G mutation of human cardiac Myosin-Binding Protein C

(other names:  IVS20-2A>G, M0)

SEQUENCE
intron 21
nucleotide change A>G
nucleotide pos. in gene 13858
UCSC Golden Path position 47317919
charge change  
codon change  
transcript change Splice donor site mutation/creates a cryptic site
translation change  


mutated amplimer sequence:
tcctcctggctctcccgtttctctgaactacattgtgtcttctgcGgaac
ctcccaagatccacctggactgcccaggccgcataccagacaccattgtg
gttgtagctggaaataagctacgtctggacgtccctatctctggggaccc
tgctcccactgtgatctggcagaaggctatcacgcaggtactgtgggtcc
ctcctcagtctccccatctataagatgggtgtgtggaaccagccaagtgc
taggacctgctgcacaccccacccacatgtgcacgccctgctgttggcta
ccccgtgggagagactggtcagggggcaggcaaggtgggcagtgtgggtc
agggggtggaagaagcagcagaggggcgc


RESTRICTION ENZYME
no information

 
disease HCM

 
    References and comments
  1. Bonne G, Carrier L, Bercovici J, Cruaud C, Richard P, Hainque B, Gautel M, Labeit S, James M, Beckmann J, Weissenbach J, Vosberg HP, Fiszman M, Komajda M, Schwartz K.
    Cardiac myosin binding protein-C gene splice acceptor site mutation is associated with familial hypertrophic cardiomyopathy.
    Nat Genet 1995 Dec;11(4):438-40. (PubMed:7493026)
  2. Tesson F, Dufour C, Moolman JC, Carrier L, al-Mahdawi S, Chojnowska L, Dubourg O, Soubrier E, Brink P, Komajda M, Guicheney P, Schwartz K, Feingold J.
    The influence of the angiotensin I converting enzyme genotype in familial hypertrophic cardiomyopathy varies with the disease gene mutation.
    J Mol Cell Cardiol. 1997 Feb;29(2):831-8. (PubMed:9140839)
  3. Charron et al., 1998.
  4. Flavigny J, Souchet M, Sebillon P, Berrebi-Bertrand I, Hainque B, Mallet A, Bril A, Schwartz K, Carrier L.
    COOH-terminal truncated cardiac myosin-binding protein C mutants resulting from familial hypertrophic cardiomyopathy mutations exhibit altered expression and/or incorporation in fetal rat cardiomyocytes.
    J Mol Biol. 1999 Nov 26;294(2):443-56. (PubMed:10610770)
  5. Richard P, Charron P, Carrier L, Ledeuil C, Cheav T, Pichereau C, Benaiche A, Isnard R, Dubourg O, Burban M, Gueffet JP, Millaire A, Desnos M, Schwartz K, Hainque B, Komajda M.
    Hypertrophic cardiomyopathy: distribution of disease genes, spectrum of mutations, and implications for a molecular diagnosis strategy.
    Circulation 2003 May 6;107(17):2227-32. Epub 2003 Apr 21. (PubMed:12707239)
  6. Flavigny J, Robert P, Camelin JC, Schwartz K, Carrier L, Berrebi-Bertrand I.
    Biomolecular interactions between human recombinant beta-MyHC and cMyBP-Cs implicated in familial hypertrophic cardiomyopathy.
    Cardiovasc Res 2003 Nov 1;60(2):388-96. (PubMed:14613868)
 

citations & disclaimer | contact us

Last modified: April 24, 2006