Project 3 > Mutation Database > MYBPC3 mutations > Gly740fs

The Gly740fs mutation of human cardiac Myosin-Binding Protein C

(other names:  G740fs, Dupl [15042..15063])

SEQUENCE
exon 24
nucleotide change dup GGCAGAGAAGGAAGATGAGGGC
nucleotide pos. in gene 15042..15063
UCSC Golden Path position 47316735..47316714
charge change  
codon change  
transcript change Frameshift/ter in exon 23
translation change  


RESTRICTION ENZYME
no information

 
disease HCM

 
    References and comments
  1. Richard P, Charron P, Carrier L, Ledeuil C, Cheav T, Pichereau C, Benaiche A, Isnard R, Dubourg O, Burban M, Gueffet JP, Millaire A, Desnos M, Schwartz K, Hainque B, Komajda M.
    Hypertrophic cardiomyopathy: distribution of disease genes, spectrum of mutations, and implications for a molecular diagnosis strategy.
    Circulation 2003 May 6;107(17):2227-32. Epub 2003 Apr 21. (PubMed:12707239)
 

citations & disclaimer | contact us

Last modified: April 24, 2006