Project 3 > Mutation Database > MYBPC3 mutations > Arg502Trp

The Arg502Trp mutation of human cardiac Myosin-Binding Protein C

(other names:  R502W, C10951T)

SEQUENCE
exon 18
nucleotide change C>T
nucleotide pos. in gene 10951
UCSC Golden Path position 47320825
amino acid changeArg>Trp
charge change -1
codon change CGG>TGG
transcript change missense
translation change substitution


mutated amplimer sequence:
ggaggagggggcgcaagtcaaatggtgagttccagaagcacggggcatgg
gtgttgggggcatctgcccagaagaggccacagcacttgccacccaccca
cccggctaggctgaaggacggggtggagctgacccgggaggagaccttca
aatacTggttcaagaaggacgggcagagacaccacctgatcatcaacgag
gccatgctggaggacgcggggcactatgcactgtgcactagcgggggcca
ggcgctggctgagctcattgtgcagggtgagcctggctgggggggcacat
gaggctttagggcttggacccctcagcccccaccccacctagccctgtag
gggagcaggcaaacctgggctcaaggcctctgtgaccttgggcctttgac


RESTRICTION ENZYME
no information

 
disease HCM

 

Date this novel mutation was originally posted on this website:   9/28/2001

    References and comments
  1. Barr, Seidman et al., 2001. (this study)
  2. Richard P, Charron P, Carrier L, Ledeuil C, Cheav T, Pichereau C, Benaiche A, Isnard R, Dubourg O, Burban M, Gueffet JP, Millaire A, Desnos M, Schwartz K, Hainque B, Komajda M.
    Hypertrophic cardiomyopathy: distribution of disease genes, spectrum of mutations, and implications for a molecular diagnosis strategy.
    Circulation 2003 May 6;107(17):2227-32. Epub 2003 Apr 21. (PubMed:12707239)
  3. Merk, Seidman et al., 2004. (this study)
  4. Van Driest SL, Vasile VC, Ommen SR, Will ML, Tajik AJ, Gersh BJ, Ackerman MJ.
    Myosin binding protein C mutations and compound heterozygosity in hypertrophic cardiomyopathy.
    J Am Coll Cardiol 2004 Nov 2;44(9):1903-10. (PubMed:15519027)
  5. Carballo S, Blair E, Watkins H.
    Novel mutations in cardiac MYBPC3 causing early onset malignant hypertrophic cardiomyopathy
    Circulation 2005, 112(17):II-411, abstract #2003 (abstract)
  6. Ingles J, Doolan A, Chiu C, Seidman J, Seidman C, Semsarian C.
    Compound and double mutations in patients with hypertrophic cardiomyopathy: implications for genetic testing and counselling.
    J Med Genet. 2005 Oct;42(10):e59. (PubMed:16199542)


Clinical features of individuals in this study having the MYBPC3:Arg502Trp mutation.
pedigree sex height (in.) weight (lb.) age of onset age at exam NYHA Class LVWT, mm. LVED LVES LA EF, % diagnosis
FU M   169   62   17 52 31 46 55 HCM
FU   70 189   32   28 45 25 37   HCM

citations & disclaimer | contact us

Last modified: June 18, 2008