Project 3 > Mutation Database > MYBPC3 mutations > Arg495Gln

The Arg495Gln mutation of human cardiac Myosin-Binding Protein C

(other names:  R495Q)

SEQUENCE
exon 18
nucleotide change G>A
nucleotide pos. in gene 10931
UCSC Golden Path position 47320845
amino acid changeArgÝGln
charge change  
codon change CGG>CAG
transcript change missense
translation change substitution


mutated amplimer sequence:
ggaggagggggcgcaagtcaaatggtgagttccagaagcacggggcatgg
gtgttgggggcatctgcccagaagaggccacagcacttgccacccaccca
cccggctaggctgaaggacggggtggagctgacccAggaggagaccttca
aataccggttcaagaaggacgggcagagacaccacctgatcatcaacgag
gccatgctggaggacgcggggcactatgcactgtgcactagcgggggcca
ggcgctggctgagctcattgtgcagggtgagcctggctgggggggcacat
gaggctttagggcttggacccctcagcccccaccccacctagccctgtag
gggagcaggcaaacctgggctcaaggcctctgtgaccttgggcctttgac


RESTRICTION ENZYME
no information

 
disease HCM

 
    References and comments
  1. Niimura H, Bachinski LL, Sangwatanaroj S, Watkins H, Chudley AE, McKenna W, Kristinsson A, Roberts R, Sole M, Maron BJ, Seidman JG, Seidman CE.
    Mutations in the gene for cardiac myosin-binding protein C and late-onset familial hypertrophic cardiomyopathy.
    N Engl J Med 1998 Apr 30;338(18):1248-57. (PubMed:9562578)
  2. Maron BJ, Niimura H, Casey SA, Soper MK, Wright GB, Seidman JG, Seidman CE.
    Development of left ventricular hypertrophy in adults in hypertrophic cardiomyopathy caused by cardiac myosin-binding protein C gene mutations.
    J Am Coll Cardiol 2001 Aug;38(2):315-21. (PubMed:11499718)
  3. Van Driest SL, Vasile VC, Ommen SR, Will ML, Tajik AJ, Gersh BJ, Ackerman MJ.
    Myosin binding protein C mutations and compound heterozygosity in hypertrophic cardiomyopathy.
    J Am Coll Cardiol 2004 Nov 2;44(9):1903-10. (PubMed:15519027)


Clinical features of individuals in this study having the MYBPC3:Arg495Gln mutation.
pedigree sex height (in.) weight (lb.) age of onset age at exam NYHA Class LVWT, mm. LVED LVES LA EF, % diagnosis
DQ M 70 149   18   18 42 25 34 78 HCM
DQ F       42   32 31 21 38 55 HCM
DQ M 68 160   73   30 40 26 42 55 HCM
DQ F 64 163   44   12 40 22 30 60 HCM

citations & disclaimer | contact us

Last modified: April 24, 2006