Project 3 > Mutation Database > MYBPC3 mutations > Ala833Thr

The Ala833Thr mutation of human cardiac Myosin-Binding Protein C

(other names:  A833T)

mutated amplimer sequence:
ccgagggaaggtggtgtggggatgcctgggttccagaccagagctgccac
ctcccctgagccaggctacatcctggagcgcaagaagaagaagagctacc
ggtggatgcggctgaacttcgacctgattcaggagctgagtcatgaaAcg
cggcgcatgatcgagggcgtggtgtacgagatgcgcgtctacgcggtcaa
cgccatcggcatgtccaggcccagccctgcctcccagcccttcatgccta
tcggtgagcctgcctggcctggtcctgccccccgccccctccccagttaa
aaacctccaataatagcaggtgctctgcaggcagccatgctagacactca
catccacagtctcctttcatcctcgactggggatactcagccgcatttta
caga

References and comments
1. Morner S, Richard P, Kazzam E, Hellman U, Hainque B, Schwartz K, Waldenstrom A.
   Identification of the genotypes causing hypertrophic cardiomyopathy in northern Sweden.
   J Mol Cell Cardiol 2003 Jul;35(7):841-9. (PubMed:12818575)
   • A833T seen in 1 of 100 healthy control subjects.
2. Alders M, Jongbloed R, Deelen W, van den Wijngaard A, Doevendans P, Ten Cate F, Regitz-Zagrosek V, Vosberg HP, van Langen I, Wilde A, Dooijes D, Mannens M.
   The 2373insG mutation in the MYBPC3 gene is a founder mutation, which accounts for nearly one-fourth of the HCM cases in the Netherlands.
   Eur Heart J 2003 Oct;24(20):1848-53. (PubMed:14563344)
   • compound heterozygote, with MYBPC3:IVS23-2delA
   • Not found in 200 control chroms (Dutch).
3. Van Driest SL, Vasile VC, Ommen SR, Will ML, Tajik AJ, Gersh BJ, Ackerman MJ.
   Myosin binding protein C mutations and compound heterozygosity in hypertrophic cardiomyopathy.
   J Am Coll Cardiol 2004 Nov 2;44(9):1903-10. (PubMed:15519027)
   • double heterozygote, with TNNT2:Arg286His
   • Not present in 400 reference alleles.

citations & disclaimer | contact us

Last modified: April 24, 2006